discussion paper in research

• USC Libraries
• Research Guides

Organizing Your Social Sciences Research Paper

• 8. The Discussion
• Purpose of Guide
• Design Flaws to Avoid
• Independent and Dependent Variables
• Glossary of Research Terms
• Reading Research Effectively
• Narrowing a Topic Idea
• Broadening a Topic Idea
• Extending the Timeliness of a Topic Idea
• Academic Writing Style
• Choosing a Title
• Making an Outline
• Paragraph Development
• Research Process Video Series
• Executive Summary
• The C.A.R.S. Model
• Background Information
• The Research Problem/Question
• Theoretical Framework
• Citation Tracking
• Content Alert Services
• Evaluating Sources
• Primary Sources
• Secondary Sources
• Tiertiary Sources
• Scholarly vs. Popular Publications
• Qualitative Methods
• Quantitative Methods
• Insiderness
• Using Non-Textual Elements
• Limitations of the Study
• Common Grammar Mistakes
• Writing Concisely
• Avoiding Plagiarism
• Footnotes or Endnotes?
• Further Readings
• Generative AI and Writing
• USC Libraries Tutorials and Other Guides
• Bibliography

The purpose of the discussion section is to interpret and describe the significance of your findings in relation to what was already known about the research problem being investigated and to explain any new understanding or insights that emerged as a result of your research. The discussion will always connect to the introduction by way of the research questions or hypotheses you posed and the literature you reviewed, but the discussion does not simply repeat or rearrange the first parts of your paper; the discussion clearly explains how your study advanced the reader's understanding of the research problem from where you left them at the end of your review of prior research.

Annesley, Thomas M. “The Discussion Section: Your Closing Argument.” Clinical Chemistry 56 (November 2010): 1671-1674.

Importance of a Good Discussion

The discussion section is often considered the most important part of your research paper because it:

• Most effectively demonstrates your ability as a researcher to think critically about an issue, to develop creative solutions to problems based upon a logical synthesis of the findings, and to formulate a deeper, more profound understanding of the research problem under investigation;
• Presents the underlying meaning of your research, notes possible implications in other areas of study, and explores possible improvements that can be made in order to further develop the concerns of your research;
• Highlights the importance of your study and how it can contribute to understanding the research problem within the field of study;
• Presents how the findings from your study revealed and helped fill gaps in the literature that had not been previously exposed or adequately described; and,
• Engages the reader in thinking critically about issues based on an evidence-based interpretation of findings; it is not governed strictly by objective reporting of information.

Annesley Thomas M. “The Discussion Section: Your Closing Argument.” Clinical Chemistry 56 (November 2010): 1671-1674; Bitchener, John and Helen Basturkmen. “Perceptions of the Difficulties of Postgraduate L2 Thesis Students Writing the Discussion Section.” Journal of English for Academic Purposes 5 (January 2006): 4-18; Kretchmer, Paul. Fourteen Steps to Writing an Effective Discussion Section. San Francisco Edit, 2003-2008.

Structure and Writing Style

I.  General Rules

These are the general rules you should adopt when composing your discussion of the results :

• Do not be verbose or repetitive; be concise and make your points clearly
• Avoid the use of jargon or undefined technical language
• Follow a logical stream of thought; in general, interpret and discuss the significance of your findings in the same sequence you described them in your results section [a notable exception is to begin by highlighting an unexpected result or a finding that can grab the reader's attention]
• Use the present verb tense, especially for established facts; however, refer to specific works or prior studies in the past tense
• If needed, use subheadings to help organize your discussion or to categorize your interpretations into themes

II.  The Content

The content of the discussion section of your paper most often includes :

• Explanation of results : Comment on whether or not the results were expected for each set of findings; go into greater depth to explain findings that were unexpected or especially profound. If appropriate, note any unusual or unanticipated patterns or trends that emerged from your results and explain their meaning in relation to the research problem.
• References to previous research : Either compare your results with the findings from other studies or use the studies to support a claim. This can include re-visiting key sources already cited in your literature review section, or, save them to cite later in the discussion section if they are more important to compare with your results instead of being a part of the general literature review of prior research used to provide context and background information. Note that you can make this decision to highlight specific studies after you have begun writing the discussion section.
• Deduction : A claim for how the results can be applied more generally. For example, describing lessons learned, proposing recommendations that can help improve a situation, or highlighting best practices.
• Hypothesis : A more general claim or possible conclusion arising from the results [which may be proved or disproved in subsequent research]. This can be framed as new research questions that emerged as a consequence of your analysis.

III.  Organization and Structure

Keep the following sequential points in mind as you organize and write the discussion section of your paper:

• Think of your discussion as an inverted pyramid. Organize the discussion from the general to the specific, linking your findings to the literature, then to theory, then to practice [if appropriate].
• Use the same key terms, narrative style, and verb tense [present] that you used when describing the research problem in your introduction.
• Begin by briefly re-stating the research problem you were investigating and answer all of the research questions underpinning the problem that you posed in the introduction.
• Describe the patterns, principles, and relationships shown by each major findings and place them in proper perspective. The sequence of this information is important; first state the answer, then the relevant results, then cite the work of others. If appropriate, refer the reader to a figure or table to help enhance the interpretation of the data [either within the text or as an appendix].
• Regardless of where it's mentioned, a good discussion section includes analysis of any unexpected findings. This part of the discussion should begin with a description of the unanticipated finding, followed by a brief interpretation as to why you believe it appeared and, if necessary, its possible significance in relation to the overall study. If more than one unexpected finding emerged during the study, describe each of them in the order they appeared as you gathered or analyzed the data. As noted, the exception to discussing findings in the same order you described them in the results section would be to begin by highlighting the implications of a particularly unexpected or significant finding that emerged from the study, followed by a discussion of the remaining findings.
• Before concluding the discussion, identify potential limitations and weaknesses if you do not plan to do so in the conclusion of the paper. Comment on their relative importance in relation to your overall interpretation of the results and, if necessary, note how they may affect the validity of your findings. Avoid using an apologetic tone; however, be honest and self-critical [e.g., in retrospect, had you included a particular question in a survey instrument, additional data could have been revealed].
• The discussion section should end with a concise summary of the principal implications of the findings regardless of their significance. Give a brief explanation about why you believe the findings and conclusions of your study are important and how they support broader knowledge or understanding of the research problem. This can be followed by any recommendations for further research. However, do not offer recommendations which could have been easily addressed within the study. This would demonstrate to the reader that you have inadequately examined and interpreted the data.

IV.  Overall Objectives

The objectives of your discussion section should include the following: I.  Reiterate the Research Problem/State the Major Findings

Briefly reiterate the research problem or problems you are investigating and the methods you used to investigate them, then move quickly to describe the major findings of the study. You should write a direct, declarative, and succinct proclamation of the study results, usually in one paragraph.

II.  Explain the Meaning of the Findings and Why They are Important

No one has thought as long and hard about your study as you have. Systematically explain the underlying meaning of your findings and state why you believe they are significant. After reading the discussion section, you want the reader to think critically about the results and why they are important. You don’t want to force the reader to go through the paper multiple times to figure out what it all means. If applicable, begin this part of the section by repeating what you consider to be your most significant or unanticipated finding first, then systematically review each finding. Otherwise, follow the general order you reported the findings presented in the results section.

III.  Relate the Findings to Similar Studies

No study in the social sciences is so novel or possesses such a restricted focus that it has absolutely no relation to previously published research. The discussion section should relate your results to those found in other studies, particularly if questions raised from prior studies served as the motivation for your research. This is important because comparing and contrasting the findings of other studies helps to support the overall importance of your results and it highlights how and in what ways your study differs from other research about the topic. Note that any significant or unanticipated finding is often because there was no prior research to indicate the finding could occur. If there is prior research to indicate this, you need to explain why it was significant or unanticipated. IV.  Consider Alternative Explanations of the Findings

It is important to remember that the purpose of research in the social sciences is to discover and not to prove . When writing the discussion section, you should carefully consider all possible explanations for the study results, rather than just those that fit your hypothesis or prior assumptions and biases. This is especially important when describing the discovery of significant or unanticipated findings.

V.  Acknowledge the Study’s Limitations

It is far better for you to identify and acknowledge your study’s limitations than to have them pointed out by your professor! Note any unanswered questions or issues your study could not address and describe the generalizability of your results to other situations. If a limitation is applicable to the method chosen to gather information, then describe in detail the problems you encountered and why. VI.  Make Suggestions for Further Research

You may choose to conclude the discussion section by making suggestions for further research [as opposed to offering suggestions in the conclusion of your paper]. Although your study can offer important insights about the research problem, this is where you can address other questions related to the problem that remain unanswered or highlight hidden issues that were revealed as a result of conducting your research. You should frame your suggestions by linking the need for further research to the limitations of your study [e.g., in future studies, the survey instrument should include more questions that ask..."] or linking to critical issues revealed from the data that were not considered initially in your research.

NOTE: Besides the literature review section, the preponderance of references to sources is usually found in the discussion section . A few historical references may be helpful for perspective, but most of the references should be relatively recent and included to aid in the interpretation of your results, to support the significance of a finding, and/or to place a finding within a particular context. If a study that you cited does not support your findings, don't ignore it--clearly explain why your research findings differ from theirs.

V.  Problems to Avoid

• Do not waste time restating your results . Should you need to remind the reader of a finding to be discussed, use "bridge sentences" that relate the result to the interpretation. An example would be: “In the case of determining available housing to single women with children in rural areas of Texas, the findings suggest that access to good schools is important...," then move on to further explaining this finding and its implications.
• As noted, recommendations for further research can be included in either the discussion or conclusion of your paper, but do not repeat your recommendations in the both sections. Think about the overall narrative flow of your paper to determine where best to locate this information. However, if your findings raise a lot of new questions or issues, consider including suggestions for further research in the discussion section.
• Do not introduce new results in the discussion section. Be wary of mistaking the reiteration of a specific finding for an interpretation because it may confuse the reader. The description of findings [results section] and the interpretation of their significance [discussion section] should be distinct parts of your paper. If you choose to combine the results section and the discussion section into a single narrative, you must be clear in how you report the information discovered and your own interpretation of each finding. This approach is not recommended if you lack experience writing college-level research papers.
• Use of the first person pronoun is generally acceptable. Using first person singular pronouns can help emphasize a point or illustrate a contrasting finding. However, keep in mind that too much use of the first person can actually distract the reader from the main points [i.e., I know you're telling me this--just tell me!].

Analyzing vs. Summarizing. Department of English Writing Guide. George Mason University; Discussion. The Structure, Format, Content, and Style of a Journal-Style Scientific Paper. Department of Biology. Bates College; Hess, Dean R. "How to Write an Effective Discussion." Respiratory Care 49 (October 2004); Kretchmer, Paul. Fourteen Steps to Writing to Writing an Effective Discussion Section. San Francisco Edit, 2003-2008; The Lab Report. University College Writing Centre. University of Toronto; Sauaia, A. et al. "The Anatomy of an Article: The Discussion Section: "How Does the Article I Read Today Change What I Will Recommend to my Patients Tomorrow?” The Journal of Trauma and Acute Care Surgery 74 (June 2013): 1599-1602; Research Limitations & Future Research . Lund Research Ltd., 2012; Summary: Using it Wisely. The Writing Center. University of North Carolina; Schafer, Mickey S. Writing the Discussion. Writing in Psychology course syllabus. University of Florida; Yellin, Linda L. A Sociology Writer's Guide . Boston, MA: Allyn and Bacon, 2009.

Writing Tip

Don’t Over-Interpret the Results!

Interpretation is a subjective exercise. As such, you should always approach the selection and interpretation of your findings introspectively and to think critically about the possibility of judgmental biases unintentionally entering into discussions about the significance of your work. With this in mind, be careful that you do not read more into the findings than can be supported by the evidence you have gathered. Remember that the data are the data: nothing more, nothing less.

MacCoun, Robert J. "Biases in the Interpretation and Use of Research Results." Annual Review of Psychology 49 (February 1998): 259-287.

Another Writing Tip

Don't Write Two Results Sections!

One of the most common mistakes that you can make when discussing the results of your study is to present a superficial interpretation of the findings that more or less re-states the results section of your paper. Obviously, you must refer to your results when discussing them, but focus on the interpretation of those results and their significance in relation to the research problem, not the data itself.

Azar, Beth. "Discussing Your Findings."  American Psychological Association gradPSYCH Magazine (January 2006).

Yet Another Writing Tip

Avoid Unwarranted Speculation!

The discussion section should remain focused on the findings of your study. For example, if the purpose of your research was to measure the impact of foreign aid on increasing access to education among disadvantaged children in Bangladesh, it would not be appropriate to speculate about how your findings might apply to populations in other countries without drawing from existing studies to support your claim or if analysis of other countries was not a part of your original research design. If you feel compelled to speculate, do so in the form of describing possible implications or explaining possible impacts. Be certain that you clearly identify your comments as speculation or as a suggestion for where further research is needed. Sometimes your professor will encourage you to expand your discussion of the results in this way, while others don’t care what your opinion is beyond your effort to interpret the data in relation to the research problem.

• << Previous: Using Non-Textual Elements
• Next: Limitations of the Study >>
• Last Updated: Oct 10, 2023 1:30 PM
• URL: https://libguides.usc.edu/writingguide

When you choose to publish with PLOS, your research makes an impact. Make your work accessible to all, without restrictions, and accelerate scientific discovery with options like preprints and published peer review that make your work more Open.

• PLOS Biology
• PLOS Climate
• PLOS Complex Systems
• PLOS Computational Biology
• PLOS Digital Health
• PLOS Genetics
• PLOS Global Public Health
• PLOS Medicine
• PLOS Mental Health
• PLOS Neglected Tropical Diseases
• PLOS Pathogens
• PLOS Sustainability and Transformation
• PLOS Collections
• How to Write Discussions and Conclusions

The discussion section contains the results and outcomes of a study. An effective discussion informs readers what can be learned from your experiment and provides context for the results.

What makes an effective discussion?

When you’re ready to write your discussion, you’ve already introduced the purpose of your study and provided an in-depth description of the methodology. The discussion informs readers about the larger implications of your study based on the results. Highlighting these implications while not overstating the findings can be challenging, especially when you’re submitting to a journal that selects articles based on novelty or potential impact. Regardless of what journal you are submitting to, the discussion section always serves the same purpose: concluding what your study results actually mean.

A successful discussion section puts your findings in context. It should include:

• the results of your research,
• a discussion of related research, and
• a comparison between your results and initial hypothesis.

Tip: Not all journals share the same naming conventions.

You can apply the advice in this article to the conclusion, results or discussion sections of your manuscript.

Our Early Career Researcher community tells us that the conclusion is often considered the most difficult aspect of a manuscript to write. To help, this guide provides questions to ask yourself, a basic structure to model your discussion off of and examples from published manuscripts. 

Questions to ask yourself:

• Was my hypothesis correct?
• If my hypothesis is partially correct or entirely different, what can be learned from the results? 
• How do the conclusions reshape or add onto the existing knowledge in the field? What does previous research say about the topic? 
• Why are the results important or relevant to your audience? Do they add further evidence to a scientific consensus or disprove prior studies? 
• How can future research build on these observations? What are the key experiments that must be done? 
• What is the “take-home” message you want your reader to leave with?

How to structure a discussion

Trying to fit a complete discussion into a single paragraph can add unnecessary stress to the writing process. If possible, you’ll want to give yourself two or three paragraphs to give the reader a comprehensive understanding of your study as a whole. Here’s one way to structure an effective discussion:

Writing Tips

While the above sections can help you brainstorm and structure your discussion, there are many common mistakes that writers revert to when having difficulties with their paper. Writing a discussion can be a delicate balance between summarizing your results, providing proper context for your research and avoiding introducing new information. Remember that your paper should be both confident and honest about the results! 

• Read the journal’s guidelines on the discussion and conclusion sections. If possible, learn about the guidelines before writing the discussion to ensure you’re writing to meet their expectations. 
• Begin with a clear statement of the principal findings. This will reinforce the main take-away for the reader and set up the rest of the discussion. 
• Explain why the outcomes of your study are important to the reader. Discuss the implications of your findings realistically based on previous literature, highlighting both the strengths and limitations of the research. 
• State whether the results prove or disprove your hypothesis. If your hypothesis was disproved, what might be the reasons? 
• Introduce new or expanded ways to think about the research question. Indicate what next steps can be taken to further pursue any unresolved questions. 
• If dealing with a contemporary or ongoing problem, such as climate change, discuss possible consequences if the problem is avoided. 
• Be concise. Adding unnecessary detail can distract from the main findings. 

Don’t

• Rewrite your abstract. Statements with “we investigated” or “we studied” generally do not belong in the discussion. 
• Include new arguments or evidence not previously discussed. Necessary information and evidence should be introduced in the main body of the paper. 
• Apologize. Even if your research contains significant limitations, don’t undermine your authority by including statements that doubt your methodology or execution. 
• Shy away from speaking on limitations or negative results. Including limitations and negative results will give readers a complete understanding of the presented research. Potential limitations include sources of potential bias, threats to internal or external validity, barriers to implementing an intervention and other issues inherent to the study design. 
• Overstate the importance of your findings. Making grand statements about how a study will fully resolve large questions can lead readers to doubt the success of the research. 

Snippets of Effective Discussions:

Consumer-based actions to reduce plastic pollution in rivers: A multi-criteria decision analysis approach

Identifying reliable indicators of fitness in polar bears

• How to Write a Great Title
• How to Write an Abstract
• How to Write Your Methods
• How to Report Statistics
• How to Edit Your Work

The contents of the Peer Review Center are also available as a live, interactive training session, complete with slides, talking points, and activities. …

The contents of the Writing Center are also available as a live, interactive training session, complete with slides, talking points, and activities. …

There’s a lot to consider when deciding where to submit your work. Learn how to choose a journal that will help your study reach its audience, while reflecting your values as a researcher…

• Affiliate Program

• UNITED STATES
• 台灣 (TAIWAN)
• TÜRKIYE (TURKEY)
• Academic Editing Services
• - Research Paper
• - Journal Manuscript
• - Dissertation
• - College & University Assignments
• Admissions Editing Services
• - Application Essay
• - Personal Statement
• - Recommendation Letter
• - Cover Letter
• - CV/Resume
• Business Editing Services
• - Business Documents
• - Report & Brochure
• - Website & Blog
• Writer Editing Services
• - Script & Screenplay
• Our Editors
• Client Reviews
• Editing & Proofreading Prices
• Wordvice Points
• Partner Discount
• Plagiarism Checker
• APA Citation Generator
• MLA Citation Generator
• Chicago Citation Generator
• Vancouver Citation Generator
• - APA Style
• - MLA Style
• - Chicago Style
• - Vancouver Style
• Writing & Editing Guide
• Academic Resources
• Admissions Resources

How to Write a Discussion Section for a Research Paper

We’ve talked about several useful writing tips that authors should consider while drafting or editing their research papers. In particular, we’ve focused on  figures and legends , as well as the Introduction ,  Methods , and  Results . Now that we’ve addressed the more technical portions of your journal manuscript, let’s turn to the analytical segments of your research article. In this article, we’ll provide tips on how to write a strong Discussion section that best portrays the significance of your research contributions.

What is the Discussion section of a research paper?

In a nutshell,  your Discussion fulfills the promise you made to readers in your Introduction . At the beginning of your paper, you tell us why we should care about your research. You then guide us through a series of intricate images and graphs that capture all the relevant data you collected during your research. We may be dazzled and impressed at first, but none of that matters if you deliver an anti-climactic conclusion in the Discussion section!

Are you feeling pressured? Don’t worry. To be honest, you will edit the Discussion section of your manuscript numerous times. After all, in as little as one to two paragraphs ( Nature ‘s suggestion  based on their 3,000-word main body text limit), you have to explain how your research moves us from point A (issues you raise in the Introduction) to point B (our new understanding of these matters). You must also recommend how we might get to point C (i.e., identify what you think is the next direction for research in this field). That’s a lot to say in two paragraphs!

So, how do you do that? Let’s take a closer look.

What should I include in the Discussion section?

As we stated above, the goal of your Discussion section is to  answer the questions you raise in your Introduction by using the results you collected during your research . The content you include in the Discussions segment should include the following information:

• Remind us why we should be interested in this research project.
• Describe the nature of the knowledge gap you were trying to fill using the results of your study.
• Don’t repeat your Introduction. Instead, focus on why  this  particular study was needed to fill the gap you noticed and why that gap needed filling in the first place.
• Mainly, you want to remind us of how your research will increase our knowledge base and inspire others to conduct further research.
• Clearly tell us what that piece of missing knowledge was.
• Answer each of the questions you asked in your Introduction and explain how your results support those conclusions.
• Make sure to factor in all results relevant to the questions (even if those results were not statistically significant).
• Focus on the significance of the most noteworthy results.
• If conflicting inferences can be drawn from your results, evaluate the merits of all of them.
• Don’t rehash what you said earlier in the Results section. Rather, discuss your findings in the context of answering your hypothesis. Instead of making statements like “[The first result] was this…,” say, “[The first result] suggests [conclusion].”
• Do your conclusions line up with existing literature?
• Discuss whether your findings agree with current knowledge and expectations.
• Keep in mind good persuasive argument skills, such as explaining the strengths of your arguments and highlighting the weaknesses of contrary opinions.
• If you discovered something unexpected, offer reasons. If your conclusions aren’t aligned with current literature, explain.
• Address any limitations of your study and how relevant they are to interpreting your results and validating your findings.
• Make sure to acknowledge any weaknesses in your conclusions and suggest room for further research concerning that aspect of your analysis.
• Make sure your suggestions aren’t ones that should have been conducted during your research! Doing so might raise questions about your initial research design and protocols.
• Similarly, maintain a critical but unapologetic tone. You want to instill confidence in your readers that you have thoroughly examined your results and have objectively assessed them in a way that would benefit the scientific community’s desire to expand our knowledge base.
• Recommend next steps.
• Your suggestions should inspire other researchers to conduct follow-up studies to build upon the knowledge you have shared with them.
• Keep the list short (no more than two).

How to Write the Discussion Section

The above list of what to include in the Discussion section gives an overall idea of what you need to focus on throughout the section. Below are some tips and general suggestions about the technical aspects of writing and organization that you might find useful as you draft or revise the contents we’ve outlined above.

Technical writing elements

• Embrace active voice because it eliminates the awkward phrasing and wordiness that accompanies passive voice.
• Use the present tense, which should also be employed in the Introduction.
• Sprinkle with first person pronouns if needed, but generally, avoid it. We want to focus on your findings.
• Maintain an objective and analytical tone.

Discussion section organization

• Keep the same flow across the Results, Methods, and Discussion sections.
• We develop a rhythm as we read and parallel structures facilitate our comprehension. When you organize information the same way in each of these related parts of your journal manuscript, we can quickly see how a certain result was interpreted and quickly verify the particular methods used to produce that result.
• Notice how using parallel structure will eliminate extra narration in the Discussion part since we can anticipate the flow of your ideas based on what we read in the Results segment. Reducing wordiness is important when you only have a few paragraphs to devote to the Discussion section!
• Within each subpart of a Discussion, the information should flow as follows: (A) conclusion first, (B) relevant results and how they relate to that conclusion and (C) relevant literature.
• End with a concise summary explaining the big-picture impact of your study on our understanding of the subject matter. At the beginning of your Discussion section, you stated why  this  particular study was needed to fill the gap you noticed and why that gap needed filling in the first place. Now, it is time to end with “how your research filled that gap.”

Discussion Part 1: Summarizing Key Findings

Begin the Discussion section by restating your  statement of the problem  and briefly summarizing the major results. Do not simply repeat your findings. Rather, try to create a concise statement of the main results that directly answer the central research question that you stated in the Introduction section . This content should not be longer than one paragraph in length.

Many researchers struggle with understanding the precise differences between a Discussion section and a Results section . The most important thing to remember here is that your Discussion section should subjectively evaluate the findings presented in the Results section, and in relatively the same order. Keep these sections distinct by making sure that you do not repeat the findings without providing an interpretation.

Phrase examples: Summarizing the results

• The findings indicate that …
• These results suggest a correlation between A and B …
• The data present here suggest that …
• An interpretation of the findings reveals a connection between…

Discussion Part 2: Interpreting the Findings

What do the results mean? It may seem obvious to you, but simply looking at the figures in the Results section will not necessarily convey to readers the importance of the findings in answering your research questions.

The exact structure of interpretations depends on the type of research being conducted. Here are some common approaches to interpreting data:

• Identifying correlations and relationships in the findings
• Explaining whether the results confirm or undermine your research hypothesis
• Giving the findings context within the history of similar research studies
• Discussing unexpected results and analyzing their significance to your study or general research
• Offering alternative explanations and arguing for your position

Organize the Discussion section around key arguments, themes, hypotheses, or research questions or problems. Again, make sure to follow the same order as you did in the Results section.

Discussion Part 3: Discussing the Implications

In addition to providing your own interpretations, show how your results fit into the wider scholarly literature you surveyed in the  literature review section. This section is called the implications of the study . Show where and how these results fit into existing knowledge, what additional insights they contribute, and any possible consequences that might arise from this knowledge, both in the specific research topic and in the wider scientific domain.

Questions to ask yourself when dealing with potential implications:

• Do your findings fall in line with existing theories, or do they challenge these theories or findings? What new information do they contribute to the literature, if any? How exactly do these findings impact or conflict with existing theories or models?
• What are the practical implications on actual subjects or demographics?
• What are the methodological implications for similar studies conducted either in the past or future?

Your purpose in giving the implications is to spell out exactly what your study has contributed and why researchers and other readers should be interested.

Phrase examples: Discussing the implications of the research

• These results confirm the existing evidence in X studies…
• The results are not in line with the foregoing theory that…
• This experiment provides new insights into the connection between…
• These findings present a more nuanced understanding of…
• While previous studies have focused on X, these results demonstrate that Y.

Step 4: Acknowledging the limitations

All research has study limitations of one sort or another. Acknowledging limitations in methodology or approach helps strengthen your credibility as a researcher. Study limitations are not simply a list of mistakes made in the study. Rather, limitations help provide a more detailed picture of what can or cannot be concluded from your findings. In essence, they help temper and qualify the study implications you listed previously.

Study limitations can relate to research design, specific methodological or material choices, or unexpected issues that emerged while you conducted the research. Mention only those limitations directly relate to your research questions, and explain what impact these limitations had on how your study was conducted and the validity of any interpretations.

Possible types of study limitations:

• Insufficient sample size for statistical measurements
• Lack of previous research studies on the topic
• Methods/instruments/techniques used to collect the data
• Limited access to data
• Time constraints in properly preparing and executing the study

After discussing the study limitations, you can also stress that your results are still valid. Give some specific reasons why the limitations do not necessarily handicap your study or narrow its scope.

Phrase examples: Limitations sentence beginners

• “There may be some possible limitations in this study.”
• “The findings of this study have to be seen in light of some limitations.”
•  “The first limitation is the…The second limitation concerns the…”
•  “The empirical results reported herein should be considered in the light of some limitations.”
• “This research, however, is subject to several limitations.”
• “The primary limitation to the generalization of these results is…”
• “Nonetheless, these results must be interpreted with caution and a number of limitations should be borne in mind.”

Discussion Part 5: Giving Recommendations for Further Research

Based on your interpretation and discussion of the findings, your recommendations can include practical changes to the study or specific further research to be conducted to clarify the research questions. Recommendations are often listed in a separate Conclusion section , but often this is just the final paragraph of the Discussion section.

Suggestions for further research often stem directly from the limitations outlined. Rather than simply stating that “further research should be conducted,” provide concrete specifics for how future can help answer questions that your research could not.

Phrase examples: Recommendation sentence beginners

• Further research is needed to establish …
• There is abundant space for further progress in analyzing…
• A further study with more focus on X should be done to investigate…
• Further studies of X that account for these variables must be undertaken.

Consider Receiving Professional Language Editing

As you edit or draft your research manuscript, we hope that you implement these guidelines to produce a more effective Discussion section. And after completing your draft, don’t forget to submit your work to a professional proofreading and English editing service like Wordvice, including our manuscript editing service for  paper editing , cover letter editing , SOP editing , and personal statement proofreading services. Language editors not only proofread and correct errors in grammar, punctuation, mechanics, and formatting but also improve terms and revise phrases so they read more naturally. Wordvice is an industry leader in providing high-quality revision for all types of academic documents.

For additional information about how to write a strong research paper, make sure to check out our full  research writing series !

Wordvice Writing Resources

• How to Write a Research Paper Introduction 
• Which Verb Tenses to Use in a Research Paper
• How to Write an Abstract for a Research Paper
• How to Write a Research Paper Title
• Useful Phrases for Academic Writing
• Common Transition Terms in Academic Papers
• Active and Passive Voice in Research Papers
• 100+ Verbs That Will Make Your Research Writing Amazing
• Tips for Paraphrasing in Research Papers

Additional Academic Resources

•   Guide for Authors.  (Elsevier)
•  How to Write the Results Section of a Research Paper.  (Bates College)
•   Structure of a Research Paper.  (University of Minnesota Biomedical Library)
•   How to Choose a Target Journal  (Springer)
•   How to Write Figures and Tables  (UNC Writing Center)

• Langson Library
• Science Library
• Grunigen Medical Library
• Law Library
• Connect From Off-Campus
• Accessibility
• Gateway Study Center

Email this link

Writing a scientific paper.

• Writing a lab report
• INTRODUCTION

Writing a "good" discussion section

"discussion and conclusions checklist" from: how to write a good scientific paper. chris a. mack. spie. 2018., peer review.

• LITERATURE CITED
• Bibliography of guides to scientific writing and presenting
• Presentations
• Lab Report Writing Guides on the Web

This is is usually the hardest section to write. You are trying to bring out the true meaning of your data without being too long. Do not use words to conceal your facts or reasoning. Also do not repeat your results, this is a discussion.

• Present principles, relationships and generalizations shown by the results
• Point out exceptions or lack of correlations. Define why you think this is so.
• Show how your results agree or disagree with previously published works
• Discuss the theoretical implications of your work as well as practical applications
• State your conclusions clearly. Summarize your evidence for each conclusion.
• Discuss the significance of the results
•  Evidence does not explain itself; the results must be presented and then explained.
• Typical stages in the discussion: summarizing the results, discussing whether results are expected or unexpected, comparing these results to previous work, interpreting and explaining the results (often by comparison to a theory or model), and hypothesizing about their generality.
• Discuss any problems or shortcomings encountered during the course of the work.
• Discuss possible alternate explanations for the results.
• Avoid: presenting results that are never discussed; presenting discussion that does not relate to any of the results; presenting results and discussion in chronological order rather than logical order; ignoring results that do not support the conclusions; drawing conclusions from results without logical arguments to back them up. 

CONCLUSIONS

• Provide a very brief summary of the Results and Discussion.
• Emphasize the implications of the findings, explaining how the work is significant and providing the key message(s) the author wishes to convey.
• Provide the most general claims that can be supported by the evidence.
• Provide a future perspective on the work.
• Avoid: repeating the abstract; repeating background information from the Introduction; introducing new evidence or new arguments not found in the Results and Discussion; repeating the arguments made in the Results and Discussion; failing to address all of the research questions set out in the Introduction. 

WHAT HAPPENS AFTER I COMPLETE MY PAPER?

 The peer review process is the quality control step in the publication of ideas.  Papers that are submitted to a journal for publication are sent out to several scientists (peers) who look carefully at the paper to see if it is "good science".  These reviewers then recommend to the editor of a journal whether or not a paper should be published. Most journals have publication guidelines. Ask for them and follow them exactly.    Peer reviewers examine the soundness of the materials and methods section.  Are the materials and methods used written clearly enough for another scientist to reproduce the experiment?  Other areas they look at are: originality of research, significance of research question studied, soundness of the discussion and interpretation, correct spelling and use of technical terms, and length of the article.

• << Previous: RESULTS
• Next: LITERATURE CITED >>
• Last Updated: Aug 4, 2023 9:33 AM
• URL: https://guides.lib.uci.edu/scientificwriting

Off-campus? Please use the Software VPN and choose the group UCIFull to access licensed content. For more information, please Click here

Software VPN is not available for guests, so they may not have access to some content when connecting from off-campus.

Organizing Academic Research Papers: 8. The Discussion

• Purpose of Guide
• Design Flaws to Avoid
• Glossary of Research Terms
• Narrowing a Topic Idea
• Broadening a Topic Idea
• Extending the Timeliness of a Topic Idea
• Academic Writing Style
• Choosing a Title
• Making an Outline
• Paragraph Development
• Executive Summary
• Background Information
• The Research Problem/Question
• Theoretical Framework
• Citation Tracking
• Content Alert Services
• Evaluating Sources
• Primary Sources
• Secondary Sources
• Tertiary Sources
• What Is Scholarly vs. Popular?
• Qualitative Methods
• Quantitative Methods
• Using Non-Textual Elements
• Limitations of the Study
• Common Grammar Mistakes
• Avoiding Plagiarism
• Footnotes or Endnotes?
• Further Readings
• Annotated Bibliography
• Dealing with Nervousness
• Using Visual Aids
• Grading Someone Else's Paper
• How to Manage Group Projects
• Multiple Book Review Essay
• Reviewing Collected Essays
• About Informed Consent
• Writing Field Notes
• Writing a Policy Memo
• Writing a Research Proposal
• Acknowledgements

The purpose of the discussion is to interpret and describe the significance of your findings in light of what was already known about the research problem being investigated, and to explain any new understanding or fresh insights about the problem after you've taken the findings into consideration. The discussion will always connect to the introduction by way of the research questions or hypotheses you posed and the literature you reviewed, but it does not simply repeat or rearrange the introduction; the discussion should always explain how your study has moved the reader's understanding of the research problem forward from where you left them at the end of the introduction.

Importance of a Good Discussion

This section is often considered the most important part of a research paper because it most effectively demonstrates your ability as a researcher to think critically about an issue, to develop creative solutions to problems based on the findings, and to formulate a deeper, more profound understanding of the research problem you are studying.

The discussion section is where you explore the underlying meaning of your research , its possible implications in other areas of study, and the possible improvements that can be made in order to further develop the concerns of your research.

This is the section where you need to present the importance of your study and how it may be able to contribute to and/or fill existing gaps in the field. If appropriate, the discussion section is also where you state how the findings from your study revealed new gaps in the literature that had not been previously exposed or adequately described.

This part of the paper is not strictly governed by objective reporting of information but, rather, it is where you can engage in creative thinking about issues through evidence-based interpretation of findings. This is where you infuse your results with meaning.

Kretchmer, Paul. Fourteen Steps to Writing to Writing an Effective Discussion Section . San Francisco Edit, 2003-2008.

Structure and Writing Style

I.  General Rules

These are the general rules you should adopt when composing your discussion of the results :

• Do not be verbose or repetitive.
• Be concise and make your points clearly.
• Avoid using jargon.
• Follow a logical stream of thought.
• Use the present verb tense, especially for established facts; however, refer to specific works and references in the past tense.
• If needed, use subheadings to help organize your presentation or to group your interpretations into themes.

II.  The Content

The content of the discussion section of your paper most often includes :

• Explanation of results : comment on whether or not the results were expected and present explanations for the results; go into greater depth when explaining findings that were unexpected or especially profound. If appropriate, note any unusual or unanticipated patterns or trends that emerged from your results and explain their meaning.
• References to previous research : compare your results with the findings from other studies, or use the studies to support a claim. This can include re-visiting key sources already cited in your literature review section, or, save them to cite later in the discussion section if they are more important to compare with your results than being part of the general research you cited to provide context and background information.
• Deduction : a claim for how the results can be applied more generally. For example, describing lessons learned, proposing recommendations that can help improve a situation, or recommending best practices.
• Hypothesis : a more general claim or possible conclusion arising from the results [which may be proved or disproved in subsequent research].

III. Organization and Structure

Keep the following sequential points in mind as you organize and write the discussion section of your paper:

• Think of your discussion as an inverted pyramid. Organize the discussion from the general to the specific, linking your findings to the literature, then to theory, then to practice [if appropriate].
• Use the same key terms, mode of narration, and verb tense [present] that you used when when describing the research problem in the introduction.
• Begin by briefly re-stating the research problem you were investigating and answer all of the research questions underpinning the problem that you posed in the introduction.
• Describe the patterns, principles, and relationships shown by each major findings and place them in proper perspective. The sequencing of providing this information is important; first state the answer, then the relevant results, then cite the work of others. If appropriate, refer the reader to a figure or table to help enhance the interpretation of the data. The order of interpreting each major finding should be in the same order as they were described in your results section.
• A good discussion section includes analysis of any unexpected findings. This paragraph should begin with a description of the unexpected finding, followed by a brief interpretation as to why you believe it appeared and, if necessary, its possible significance in relation to the overall study. If more than one unexpected finding emerged during the study, describe each them in the order they appeared as you gathered the data.
• Before concluding the discussion, identify potential limitations and weaknesses. Comment on their relative importance in relation to your overall interpretation of the results and, if necessary, note how they may affect the validity of the findings. Avoid using an apologetic tone; however, be honest and self-critical.
• The discussion section should end with a concise summary of the principal implications of the findings regardless of statistical significance. Give a brief explanation about why you believe the findings and conclusions of your study are important and how they support broader knowledge or understanding of the research problem. This can be followed by any recommendations for further research. However, do not offer recommendations which could have been easily addressed within the study. This demonstrates to the reader you have inadequately examined and interpreted the data.

IV.  Overall Objectives

The objectives of your discussion section should include the following: I.  Reiterate the Research Problem/State the Major Findings

Briefly reiterate for your readers the research problem or problems you are investigating and the methods you used to investigate them, then move quickly to describe the major findings of the study. You should write a direct, declarative, and succinct proclamation of the study results.

II.  Explain the Meaning of the Findings and Why They are Important

No one has thought as long and hard about your study as you have. Systematically explain the meaning of the findings and why you believe they are important. After reading the discussion section, you want the reader to think about the results [“why hadn’t I thought of that?”]. You don’t want to force the reader to go through the paper multiple times to figure out what it all means. Begin this part of the section by repeating what you consider to be your most important finding first.

III.  Relate the Findings to Similar Studies

No study is so novel or possesses such a restricted focus that it has absolutely no relation to other previously published research. The discussion section should relate your study findings to those of other studies, particularly if questions raised by previous studies served as the motivation for your study, the findings of other studies support your findings [which strengthens the importance of your study results], and/or they point out how your study differs from other similar studies. IV.  Consider Alternative Explanations of the Findings

It is important to remember that the purpose of research is to discover and not to prove . When writing the discussion section, you should carefully consider all possible explanations for the study results, rather than just those that fit your prior assumptions or biases.

V.  Acknowledge the Study’s Limitations

It is far better for you to identify and acknowledge your study’s limitations than to have them pointed out by your professor! Describe the generalizability of your results to other situations, if applicable to the method chosen, then describe in detail problems you encountered in the method(s) you used to gather information. Note any unanswered questions or issues your study did not address, and.... VI.  Make Suggestions for Further Research

Although your study may offer important insights about the research problem, other questions related to the problem likely remain unanswered. Moreover, some unanswered questions may have become more focused because of your study. You should make suggestions for further research in the discussion section.

NOTE: Besides the literature review section, the preponderance of references to sources in your research paper are usually found in the discussion section . A few historical references may be helpful for perspective but most of the references should be relatively recent and included to aid in the interpretation of your results and/or linked to similar studies. If a study that you cited disagrees with your findings, don't ignore it--clearly explain why the study's findings differ from yours.

V.  Problems to Avoid

• Do not waste entire sentences restating your results . Should you need to remind the reader of the finding to be discussed, use "bridge sentences" that relate the result to the interpretation. An example would be: “The lack of available housing to single women with children in rural areas of Texas suggests that...[then move to the interpretation of this finding].”
• Recommendations for further research can be included in either the discussion or conclusion of your paper but do not repeat your recommendations in the both sections.
• Do not introduce new results in the discussion. Be wary of mistaking the reiteration of a specific finding for an interpretation.
• Use of the first person is acceptable, but too much use of the first person may actually distract the reader from the main points.

Analyzing vs. Summarizing. Department of English Writing Guide. George Mason University; Discussion . The Structure, Format, Content, and Style of a Journal-Style Scientific Paper. Department of Biology. Bates College; Hess, Dean R. How to Write an Effective Discussion. Respiratory Care 49 (October 2004); Kretchmer, Paul. Fourteen Steps to Writing to Writing an Effective Discussion Section . San Francisco Edit, 2003-2008; The Lab Report . University College Writing Centre. University of Toronto; Summary: Using it Wisely . The Writing Center. University of North Carolina; Schafer, Mickey S. Writing the Discussion . Writing in Psychology course syllabus. University of Florida; Yellin, Linda L. A Sociology Writer's Guide. Boston, MA: Allyn and Bacon, 2009.

Writing Tip

Don’t Overinterpret the Results!

Interpretation is a subjective exercise. Therefore, be careful that you do not read more into the findings than can be supported by the evidence you've gathered. Remember that the data are the data: nothing more, nothing less.

Another Writing Tip

Don't Write Two Results Sections!

One of the most common mistakes that you can make when discussing the results of your study is to present a superficial interpretation of the findings that more or less re-states the results section of your paper. Obviously, you must refer to your results when discussing them, but focus on the interpretion of those results, not just the data itself.

Azar, Beth. Discussing Your Findings.  American Psychological Association gradPSYCH Magazine (January 2006)

Yet Another Writing Tip

Avoid Unwarranted Speculation!

The discussion section should remain focused on the findings of your study. For example, if you studied the impact of foreign aid on increasing levels of education among the poor in Bangladesh, it's generally not appropriate to speculate about how your findings might apply to populations in other countries without drawing from existing studies to support your claim. If you feel compelled to speculate, be certain that you clearly identify your comments as speculation or as a suggestion for where further research is needed. Sometimes your professor will encourage you to expand the discussion in this way, while others don’t care what your opinion is beyond your efforts to interpret the data.

• << Previous: Using Non-Textual Elements
• Next: Limitations of the Study >>
• Last Updated: Jul 18, 2023 11:58 AM
• URL: https://library.sacredheart.edu/c.php?g=29803
• QuickSearch
• Library Catalog
• Databases A-Z
• Publication Finder
• Course Reserves
• Citation Linker
• Digital Commons

Research Support

• Ask a Librarian
• Appointments
• Interlibrary Loan (ILL)
• Research Guides
• Databases by Subject
• Citation Help

Using the Library

• Reserve a Group Study Room
• Renew Books
• Honors Study Rooms
• Off-Campus Access
• Library Policies
• Library Technology

User Information

• Grad Students
• Online Students
• COVID-19 Updates
• Staff Directory
• News & Announcements
• Library Newsletter

My Accounts

• Interlibrary Loan
• Staff Site Login

FIND US ON  

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• Advanced Search
• Journal List
• Turk J Urol
• v.39(Suppl 1); 2013 Sep

How to write a discussion section?

Writing manuscripts to describe study outcomes, although not easy, is the main task of an academician. The aim of the present review is to outline the main aspects of writing the discussion section of a manuscript. Additionally, we address various issues regarding manuscripts in general. It is advisable to work on a manuscript regularly to avoid losing familiarity with the article. On principle, simple, clear and effective language should be used throughout the text. In addition, a pre-peer review process is recommended to obtain feedback on the manuscript. The discussion section can be written in 3 parts: an introductory paragraph, intermediate paragraphs and a conclusion paragraph. For intermediate paragraphs, a “divide and conquer” approach, meaning a full paragraph describing each of the study endpoints, can be used. In conclusion, academic writing is similar to other skills, and practice makes perfect.

Introduction

Sharing knowledge produced during academic life is achieved through writing manuscripts. However writing manuscripts is a challenging endeavour in that we physicians have a heavy workload, and English which is common language used for the dissemination of scientific knowledge is not our mother tongue.

The objective of this review is to summarize the method of writing ‘Discussion’ section which is the most important, but probably at the same time the most unlikable part of a manuscript, and demonstrate the easy ways we applied in our practice, and finally share the frequently made relevant mistakes. During this procedure, inevitably some issues which concerns general concept of manuscript writing process are dealt with. Therefore in this review we will deal with topics related to the general aspects of manuscript writing process, and specifically issues concerning only the ‘Discussion’ section.

A) Approaches to general aspects of manuscript writing process:

1. what should be the strategy of sparing time for manuscript writing be.

Two different approaches can be formulated on this issue? One of them is to allocate at least 30 minutes a day for writing a manuscript which amounts to 3.5 hours a week. This period of time is adequate for completion of a manuscript within a few weeks which can be generally considered as a long time interval. Fundamental advantage of this approach is to gain a habit of making academic researches if one complies with the designated time schedule, and to keep the manuscript writing motivation at persistently high levels. Another approach concerning this issue is to accomplish manuscript writing process within a week. With the latter approach, the target is rapidly attained. However longer time periods spent in order to concentrate on the subject matter can be boring, and lead to loss of motivation. Daily working requirements unrelated to the manuscript writing might intervene, and prolong manuscript writing process. Alienation periods can cause loss of time because of need for recurrent literature reviews. The most optimal approach to manuscript writing process is daily writing strategy where higher levels of motivation are persistently maintained.

Especially before writing the manuscript, the most important step at the start is to construct a draft, and completion of the manuscript on a theoretical basis. Therefore, during construction of a draft, attention distracting environment should be avoided, and this step should be completed within 1–2 hours. On the other hand, manuscript writing process should begin before the completion of the study (even the during project stage). The justification of this approach is to see the missing aspects of the study and the manuscript writing methodology, and try to solve the relevant problems before completion of the study. Generally, after completion of the study, it is very difficult to solve the problems which might be discerned during the writing process. Herein, at least drafts of the ‘Introduction’, and ‘Material and Methods’ can be written, and even tables containing numerical data can be constructed. These tables can be written down in the ‘Results’ section. [ 1 ]

2. How should the manuscript be written?

The most important principle to be remembered on this issue is to obey the criteria of simplicity, clarity, and effectiveness. [ 2 ] Herein, do not forget that, the objective should be to share our findings with the readers in an easily comprehensible format. Our approach on this subject is to write all structured parts of the manuscript at the same time, and start writing the manuscript while reading the first literature. Thus newly arisen connotations, and self-brain gyms will be promptly written down. However during this process your outcomes should be revealed fully, and roughly the message of the manuscript which be delivered. Thus with this so-called ‘hunter’s approach’ the target can be achieved directly, and rapidly. Another approach is ‘collectioner’s approach. [ 3 ] In this approach, firstly, potential data, and literature studies are gathered, read, and then selected ones are used. Since this approach suits with surgical point of view, probably ‘hunter’s approach’ serves our purposes more appropriately. However, in parallel with academic development, our novice colleague ‘manuscripters’ can prefer ‘collectioner’s approach.’

On the other hand, we think that research team consisting of different age groups has some advantages. Indeed young colleagues have the enthusiasm, and energy required for the conduction of the study, while middle-aged researchers have the knowledge to manage the research, and manuscript writing. Experienced researchers make guiding contributions to the manuscript. However working together in harmony requires assignment of a chief researcher, and periodically organizing advancement meetings. Besides, talents, skills, and experiences of the researchers in different fields (ie. research methods, contact with patients, preparation of a project, fund-raising, statistical analysis etc.) will determine task sharing, and make a favourable contribution to the perfection of the manuscript. Achievement of the shared duties within a predetermined time frame will sustain the motivation of the researchers, and prevent wearing out of updated data.

According to our point of view, ‘Abstract’ section of the manuscript should be written after completion of the manuscript. The reason for this is that during writing process of the main text, the significant study outcomes might become insignificant or vice versa. However, generally, before onset of the writing process of the manuscript, its abstract might be already presented in various congresses. During writing process, this abstract might be a useful guide which prevents deviation from the main objective of the manuscript.

On the other hand references should be promptly put in place while writing the manuscript, Sorting, and placement of the references should not be left to the last moment. Indeed, it might be very difficult to remember relevant references to be placed in the ‘Discussion’ section. For the placement of references use of software programs detailed in other sections is a rational approach.

3. Which target journal should be selected?

In essence, the methodology to be followed in writing the ‘Discussion’ section is directly related to the selection of the target journal. Indeed, in compliance with the writing rules of the target journal, limitations made on the number of words after onset of the writing process, effects mostly the ‘Discussion’ section. Proper matching of the manuscript with the appropriate journal requires clear, and complete comprehension of the available data from scientific point of view. Previously, similar articles might have been published, however innovative messages, and new perspectives on the relevant subject will facilitate acceptance of the article for publication. Nowadays, articles questioning available information, rather than confirmatory ones attract attention. However during this process, classical information should not be questioned except for special circumstances. For example manuscripts which lead to the conclusions as “laparoscopic surgery is more painful than open surgery” or “laparoscopic surgery can be performed without prior training” will not be accepted or they will be returned by the editor of the target journal to the authors with the request of critical review. Besides the target journal to be selected should be ready to accept articles with similar concept. In fact editors of the journal will not reserve the limited space in their journal for articles yielding similar conclusions.

The title of the manuscript is as important as the structured sections * of the manuscript. The title can be the most striking or the newest outcome among results obtained.

Before writing down the manuscript, determination of 2–3 titles increases the motivation of the authors towards the manuscript. During writing process of the manuscript one of these can be selected based on the intensity of the discussion. However the suitability of the title to the agenda of the target journal should be investigated beforehand. For example an article bearing the title “Use of barbed sutures in laparoscopic partial nephrectomy shortens warm ischemia time” should not be sent to “Original Investigations and Seminars in Urologic Oncology” Indeed the topic of the manuscript is out of the agenda of this journal.

4. Do we have to get a pre-peer review about the written manuscript?

Before submission of the manuscript to the target journal the opinions of internal, and external referees should be taken. [ 1 ] Internal referees can be considered in 2 categories as “General internal referees” and “expert internal referees” General internal referees (ie. our colleagues from other medical disciplines) are not directly concerned with your subject matter but as mentioned above they critically review the manuscript as for simplicity, clarity, and effectiveness of its writing style. Expert internal reviewers have a profound knowledge about the subject, and they can provide guidance about the writing process of the manuscript (ie. our senior colleagues more experienced than us). External referees are our colleagues who did not contribute to data collection of our study in any way, but we can request their opinions about the subject matter of the manuscript. Since they are unrelated both to the author(s), and subject matter of the manuscript, these referees can review our manuscript more objectively. Before sending the manuscript to internal, and external referees, we should contact with them, and ask them if they have time to review our manuscript. We should also give information about our subject matter. Otherwise pre-peer review process can delay publication of the manuscript, and decrease motivation of the authors. In conclusion, whoever the preferred referee will be, these internal, and external referees should respond the following questions objectively. 1) Does the manuscript contribute to the literature?; 2) Does it persuasive? 3) Is it suitable for the publication in the selected journal? 4) Has a simple, clear, and effective language been used throughout the manuscript? In line with the opinions of the referees, the manuscript can be critically reviewed, and perfected. [ 1 ]**

Following receival of the opinions of internal, and external referees, one should concentrate priorly on indicated problems, and their solutions. Comments coming from the reviewers should be criticized, but a defensive attitude should not be assumed during this evaluation process. During this “incubation” period where the comments of the internal, and external referees are awaited, literature should be reviewed once more. Indeed during this time interval a new article which you should consider in the ‘Discussion’ section can be cited in the literature.

5. What are the common mistakes made related to the writing process of a manuscript?

Probably the most important mistakes made related to the writing process of a manuscript include lack of a clear message of the manuscript , inclusion of more than one main idea in the same text or provision of numerous unrelated results at the same time so as to reinforce the assertions of the manuscript. This approach can be termed roughly as “loss of the focus of the study” In conclusion, the author(s) should ask themselves the following question at every stage of the writing process:. “What is the objective of the study? If you always get clear-cut answers whenever you ask this question, then the study is proceeding towards the right direction. Besides application of a template which contains the intended clear-cut messages to be followed will contribute to the communication of net messages.

One of the important mistakes is refraining from critical review of the manuscript as a whole after completion of the writing process. Therefore, the authors should go over the manuscript for at least three times after finalization of the manuscript based on joint decision. The first control should concentrate on the evaluation of the appropriateness of the logic of the manuscript, and its organization, and whether desired messages have been delivered or not. Secondly, syutax, and grammar of the manuscript should be controlled. It is appropriate to review the manuscript for the third time 1 or 2 weeks after completion of its writing process. Thus, evaluation of the “cooled” manuscript will be made from a more objective perspective, and assessment process of its integrity will be facilitated.

Other erroneous issues consist of superfluousness of the manuscript with unnecessary repetitions, undue, and recurrent references to the problems adressed in the manuscript or their solution methods, overcriticizing or overpraising other studies, and use of a pompous literary language overlooking the main objective of sharing information. [ 4 ]

B) Approaches to the writing process of the ‘Discussion’ section:

1. how should the main points of ‘discussion’ section be constructed.

Generally the length of the ‘Discussion ‘ section should not exceed the sum of other sections (ıntroduction, material and methods, and results), and it should be completed within 6–7 paragraphs.. Each paragraph should not contain more than 200 words, and hence words should be counted repeteadly. The ‘Discussion’ section can be generally divided into 3 separate paragraphs as. 1) Introductory paragraph, 2) Intermediate paragraphs, 3) Concluding paragraph.

The introductory paragraph contains the main idea of performing the study in question. Without repeating ‘Introduction’ section of the manuscript, the problem to be addressed, and its updateness are analysed. The introductory paragraph starts with an undebatable sentence, and proceeds with a part addressing the following questions as 1) On what issue we have to concentrate, discuss or elaborate? 2) What solutions can be recommended to solve this problem? 3) What will be the new, different, and innovative issue? 4) How will our study contribute to the solution of this problem An introductory paragraph in this format is helpful to accomodate reader to the rest of the Discussion section. However summarizing the basic findings of the experimental studies in the first paragraph is generally recommended by the editors of the journal. [ 5 ]

In the last paragraph of the Discussion section “strong points” of the study should be mentioned using “constrained”, and “not too strongly assertive” statements. Indicating limitations of the study will reflect objectivity of the authors, and provide answers to the questions which will be directed by the reviewers of the journal. On the other hand in the last paragraph, future directions or potential clinical applications may be emphasized.

2. How should the intermediate paragraphs of the Discussion section be formulated?

The reader passes through a test of boredom while reading paragraphs of the Discussion section apart from the introductory, and the last paragraphs. Herein your findings rather than those of the other researchers are discussed. The previous studies can be an explanation or reinforcement of your findings. Each paragraph should contain opinions in favour or against the topic discussed, critical evaluations, and learning points.

Our management approach for intermediate paragraphs is “divide and conquer” tactics. Accordingly, the findings of the study are determined in order of their importance, and a paragraph is constructed for each finding ( Figure 1 ). Each paragraph begins with an “indisputable” introductory sentence about the topic to be discussed. This sentence basically can be the answer to the question “What have we found?” Then a sentence associated with the subject matter to be discussed is written. Subsequently, in the light of the current literature this finding is discussed, new ideas on this subject are revealed, and the paragraph ends with a concluding remark.

Divide and Conquer tactics

In this paragraph, main topic should be emphasized without going into much detail. Its place, and importance among other studies should be indicated. However during this procedure studies should be presented in a logical sequence (ie. from past to present, from a few to many cases), and aspects of the study contradictory to other studies should be underlined. Results without any supportive evidence or equivocal results should not be written. Besides numerical values presented in the Results section should not be repeated unless required.

Besides, asking the following questions, and searching their answers in the same paragraph will facilitate writing process of the paragraph. [ 1 ] 1) Can the discussed result be false or inadequate? 2) Why is it false? (inadequate blinding, protocol contamination, lost to follow-up, lower statistical power of the study etc.), 3) What meaning does this outcome convey?

3. What are the common mistakes made in writing the Discussion section?:

Probably the most important mistake made while writing the Discussion section is the need for mentioning all literature references. One point to remember is that we are not writing a review article, and only the results related to this paragraph should be discussed. Meanwhile, each word of the paragraphs should be counted, and placed carefully. Each word whose removal will not change the meaning should be taken out from the text.” Writing a saga with “word salads” *** is one of the reasons for prompt rejection. Indeed, if the reviewer thinks that it is difficult to correct the Discussion section, he/she use her/ his vote in the direction of rejection to save time (Uniform requirements for manuscripts: International Comittee of Medical Journal Editors [ http://www.icmje.org/urm_full.pdf ])

The other important mistake is to give too much references, and irrelevancy between the references, and the section with these cited references. [ 3 ] While referring these studies, (excl. introductory sentences linking indisputable sentences or paragraphs) original articles should be cited. Abstracts should not be referred, and review articles should not be cited unless required very much.

4. What points should be paid attention about writing rules, and grammar?

As is the case with the whole article, text of the Discussion section should be written with a simple language, as if we are talking with our colleague. [ 2 ] Each sentence should indicate a single point, and it should not exceed 25–30 words. The priorly mentioned information which linked the previous sentence should be placed at the beginning of the sentence, while the new information should be located at the end of the sentence. During construction of the sentences, avoid unnecessary words, and active voice rather than passive voice should be used.**** Since conventionally passive voice is used in the scientific manuscripts written in the Turkish language, the above statement contradicts our writing habits. However, one should not refrain from beginning the sentences with the word “we”. Indeed, editors of the journal recommend use of active voice so as to increase the intelligibility of the manuscript.

In conclusion, the major point to remember is that the manuscript should be written complying with principles of simplicity, clarity, and effectiveness. In the light of these principles, as is the case in our daily practice, all components of the manuscript (IMRAD) can be written concurrently. In the ‘Discussion’ section ‘divide and conquer’ tactics remarkably facilitates writing process of the discussion. On the other hand, relevant or irrelevant feedbacks received from our colleagues can contribute to the perfection of the manuscript. Do not forget that none of the manuscripts is perfect, and one should not refrain from writing because of language problems, and related lack of experience.

Instead of structured sections of a manuscript (IMRAD): Introduction, Material and Methods, Results, and Discussion

Instead of in the Istanbul University Faculty of Medicine posters to be submitted in congresses are time to time discussed in Wednesday meetings, and opinions of the internal referees are obtained about the weak, and strong points of the study

Instead of a writing style which uses words or sentences with a weak logical meaning that do not lead the reader to any conclusion

Instead of “white color”; “proven”; nstead of “history”; “to”. should be used instead of “white in color”, “definitely proven”, “past history”, and “in order to”, respectively ( ref. 2 )

Instead of “No instances of either postoperative death or major complications occurred during the early post-operative period” use “There were no deaths or major complications occurred during the early post-operative period.

Instead of “Measurements were performed to evaluate the levels of CEA in the serum” use “We measured serum CEA levels”

How to Write the Discussion Section of a Research Paper

The discussion section of a research paper analyzes and interprets the findings, provides context, compares them with previous studies, identifies limitations, and suggests future research directions.

Updated on September 15, 2023

Structure your discussion section right, and you’ll be cited more often while doing a greater service to the scientific community. So, what actually goes into the discussion section? And how do you write it?

The discussion section of your research paper is where you let the reader know how your study is positioned in the literature, what to take away from your paper, and how your work helps them. It can also include your conclusions and suggestions for future studies.

First, we’ll define all the parts of your discussion paper, and then look into how to write a strong, effective discussion section for your paper or manuscript.

Discussion section: what is it, what it does

The discussion section comes later in your paper, following the introduction, methods, and results. The discussion sets up your study’s conclusions. Its main goals are to present, interpret, and provide a context for your results.

What is it?

The discussion section provides an analysis and interpretation of the findings, compares them with previous studies, identifies limitations, and suggests future directions for research.

This section combines information from the preceding parts of your paper into a coherent story. By this point, the reader already knows why you did your study (introduction), how you did it (methods), and what happened (results). In the discussion, you’ll help the reader connect the ideas from these sections.

Why is it necessary?

The discussion provides context and interpretations for the results. It also answers the questions posed in the introduction. While the results section describes your findings, the discussion explains what they say. This is also where you can describe the impact or implications of your research.

Adds context for your results

Most research studies aim to answer a question, replicate a finding, or address limitations in the literature. These goals are first described in the introduction. However, in the discussion section, the author can refer back to them to explain how the study's objective was achieved. 

Shows what your results actually mean and real-world implications

The discussion can also describe the effect of your findings on research or practice. How are your results significant for readers, other researchers, or policymakers?

What to include in your discussion (in the correct order)

A complete and effective discussion section should at least touch on the points described below.

Summary of key findings

The discussion should begin with a brief factual summary of the results. Concisely overview the main results you obtained.

Begin with key findings with supporting evidence

Your results section described a list of findings, but what message do they send when you look at them all together?

Your findings were detailed in the results section, so there’s no need to repeat them here, but do provide at least a few highlights. This will help refresh the reader’s memory and help them focus on the big picture.

Read the first paragraph of the discussion section in this article (PDF) for an example of how to start this part of your paper. Notice how the authors break down their results and follow each description sentence with an explanation of why each finding is relevant. 

State clearly and concisely

Following a clear and direct writing style is especially important in the discussion section. After all, this is where you will make some of the most impactful points in your paper. While the results section often contains technical vocabulary, such as statistical terms, the discussion section lets you describe your findings more clearly. 

Interpretation of results

Once you’ve given your reader an overview of your results, you need to interpret those results. In other words, what do your results mean? Discuss the findings’ implications and significance in relation to your research question or hypothesis.

Analyze and interpret your findings

Look into your findings and explore what’s behind them or what may have caused them. If your introduction cited theories or studies that could explain your findings, use these sources as a basis to discuss your results.

For example, look at the second paragraph in the discussion section of this article on waggling honey bees. Here, the authors explore their results based on information from the literature.

Unexpected or contradictory results

Sometimes, your findings are not what you expect. Here’s where you describe this and try to find a reason for it. Could it be because of the method you used? Does it have something to do with the variables analyzed? Comparing your methods with those of other similar studies can help with this task.

Context and comparison with previous work

Refer to related studies to place your research in a larger context and the literature. Compare and contrast your findings with existing literature, highlighting similarities, differences, and/or contradictions.

How your work compares or contrasts with previous work

Studies with similar findings to yours can be cited to show the strength of your findings. Information from these studies can also be used to help explain your results. Differences between your findings and others in the literature can also be discussed here. 

How to divide this section into subsections

If you have more than one objective in your study or many key findings, you can dedicate a separate section to each of these. Here’s an example of this approach. You can see that the discussion section is divided into topics and even has a separate heading for each of them. 

Limitations

Many journals require you to include the limitations of your study in the discussion. Even if they don’t, there are good reasons to mention these in your paper.

Why limitations don’t have a negative connotation

A study’s limitations are points to be improved upon in future research. While some of these may be flaws in your method, many may be due to factors you couldn’t predict.

Examples include time constraints or small sample sizes. Pointing this out will help future researchers avoid or address these issues. This part of the discussion can also include any attempts you have made to reduce the impact of these limitations, as in this study .

How limitations add to a researcher's credibility

Pointing out the limitations of your study demonstrates transparency. It also shows that you know your methods well and can conduct a critical assessment of them.  

Implications and significance

The final paragraph of the discussion section should contain the take-home messages for your study. It can also cite the “strong points” of your study, to contrast with the limitations section.

Restate your hypothesis

Remind the reader what your hypothesis was before you conducted the study. 

How was it proven or disproven?

Identify your main findings and describe how they relate to your hypothesis.

How your results contribute to the literature

Were you able to answer your research question? Or address a gap in the literature?

Future implications of your research

Describe the impact that your results may have on the topic of study. Your results may show, for instance, that there are still limitations in the literature for future studies to address. There may be a need for studies that extend your findings in a specific way. You also may need additional research to corroborate your findings. 

Sample discussion section

This fictitious example covers all the aspects discussed above. Your actual discussion section will probably be much longer, but you can read this to get an idea of everything your discussion should cover.

Our results showed that the presence of cats in a household is associated with higher levels of perceived happiness by its human occupants. These findings support our hypothesis and demonstrate the association between pet ownership and well-being. 

The present findings align with those of Bao and Schreer (2016) and Hardie et al. (2023), who observed greater life satisfaction in pet owners relative to non-owners. Although the present study did not directly evaluate life satisfaction, this factor may explain the association between happiness and cat ownership observed in our sample.

Our findings must be interpreted in light of some limitations, such as the focus on cat ownership only rather than pets as a whole. This may limit the generalizability of our results.

Nevertheless, this study had several strengths. These include its strict exclusion criteria and use of a standardized assessment instrument to investigate the relationships between pets and owners. These attributes bolster the accuracy of our results and reduce the influence of confounding factors, increasing the strength of our conclusions. Future studies may examine the factors that mediate the association between pet ownership and happiness to better comprehend this phenomenon.

This brief discussion begins with a quick summary of the results and hypothesis. The next paragraph cites previous research and compares its findings to those of this study. Information from previous studies is also used to help interpret the findings. After discussing the results of the study, some limitations are pointed out. The paper also explains why these limitations may influence the interpretation of results. Then, final conclusions are drawn based on the study, and directions for future research are suggested.

How to make your discussion flow naturally

If you find writing in scientific English challenging, the discussion and conclusions are often the hardest parts of the paper to write. That’s because you’re not just listing up studies, methods, and outcomes. You’re actually expressing your thoughts and interpretations in words.

• How formal should it be?
• What words should you use, or not use?
• How do you meet strict word limits, or make it longer and more informative?

Always give it your best, but sometimes a helping hand can, well, help. Getting a professional edit can help clarify your work’s importance while improving the English used to explain it. When readers know the value of your work, they’ll cite it. We’ll assign your study to an expert editor knowledgeable in your area of research. Their work will clarify your discussion, helping it to tell your story. Find out more about AJE Editing.

Adam Goulston, PsyD, MS, MBA, MISD, ELS

Science Marketing Consultant

See our "Privacy Policy"

Ensure your structure and ideas are consistent and clearly communicated

Pair your Premium Editing with our add-on service Presubmission Review for an overall assessment of your manuscript.

How to Practice Academic Medicine and Publish from Developing Countries? pp 225–230 Cite as

How to Write the Discussion?

• Samiran Nundy 4 ,
• Atul Kakar 5 &
• Zulfiqar A. Bhutta 6  
• Open Access
• First Online: 24 October 2021

25k Accesses

Many authors, and editors, think this is the most difficult part of a paper to write well and have described it variously to be the ‘narrating the story of your research’, ‘the movie or the main scientific script’ and the ‘proof of the pudding’. The idea of a discussion is to communicate to the readers the importance of your observations and the results of all your hard work. In this section, you are expected to infer their meaning and explain the importance of your results and finally provide specific suggestions for future research [1, 2]. The discussion places the outcome into a larger context and mentions the implications of the inferences for theoretical and practical purposes [3].

That then is the first draft and you should never think of having fewer than six drafts Stephen Lock, BMJ editor in chief (1929–…)

Download chapter PDF

1 What Is the Importance of the Discussion?

Many authors, and editors, think this is the most difficult part of a paper to write well and have described it variously to be the ‘narrating the story of your research’, ‘the movie or the main scientific script’ and the ‘proof of the pudding’. The idea of a discussion is to communicate to the readers the importance of your observations and the results of all your hard work. In this section, you are expected to infer their meaning and explain the importance of your results and finally provide specific suggestions for future research [ 1 , 2 ]. The discussion places the outcome into a larger context and mentions the implications of the inferences for theoretical and practical purposes [ 3 ].

2 How Should I Structure the Discussion Section?

There are three major portions for the discussion of a manuscript.

The first paragraph should baldly state the key findings of your research. Use the same key concept you gave in the introduction. It is generally not necessary to repeat the citations which have already been used in the Introduction. According to the ‘serial position effect’, themes mentioned at the beginning and end of a paragraph are more likely to be remembered than those in the middle [ 1 ]. However, one should remember that the discussion should not look like a second introduction, and all the ancillary information which has been previously cited should not be repeated [ 4 ].

For example, in a paper on the ‘Role of sulfasalazine in the Chikungunya arthritis outbreak of 2016’, the review may start with, ‘Our key findings suggest that chikungunya arthralgia is a self-limiting disorder. Persistent arthritis was recorded in only 10% of the affected population and in those who received sulfasalazine, clinical improvement both in tender and swollen joints, was recorded in 95% of the subjects’.

The middle portion should consist of the body of the discussion. This section interprets the important results, discusses their implications and explains how your data is similar to or different from those that have been published previously.

Discuss in fair detail studies supporting your findings and group them together, against those offering a different perspective (e.g., Western experience, smaller numbers, non-randomized studies, etc.). An explanation should be offered on how your work is similar to others or how it is different from the others. This should be followed by a review of the core research papers. The results should now be divided thematically and analyzed. The discussion should also contain why the study is new, why it is true, and why it is important for future clinical practice [ 4 , 5 , 6 ].

For the above research mention the clinical features, patterns of joint involvement, how long arthritis persisted, and any role of disease-modifying agents. Have any other researchers found different findings under the same circumstances.

The final paragraph should include a ‘take home message’ (about one or two) and point to future directions for investigation that have resulted from this study.

The discussion can be concluded in two ways:

By again mentioning the response to the research question [ 5 , 7 ]

By indicating the significance of the study [ 2 , 4 ]

You can use both methods to end this section. Most importantly you should remember that the last paragraph of the discussion should be ‘strong, clear, and crisp’ and focus on the main research question addressed in the manuscript. This should be strengthened by the data which clearly states whether or not your findings support your initial hypothesis [ 1 , 5 , 8 , 9 , 10 ].

3 What Are the General Considerations for Writing a Discussion? [ 3 , 10 , 11 ]

Start the discussion with the ‘specific’ problems and move to the ‘general’ implications (Fig. 21.1 ).

The discussion should not look like a mass of unrelated information. Rather, it should be easy to understand and compare data from different studies.

Include only recent publications on the topic, preferably from the last 10 years.

Make certain that all the sources of information are cited and correctly referenced.

Check to make sure that you have not plagiarized by using words quoted directly from a source.

The written text written should be easily understood, crisp, and brief. Long descriptive and informal language should be avoided.

The sentences should flow smoothly and logically.

You need not refer to all the available literature in the field, discuss only the most relevant papers.

How a discussion should look. First arrow—Mention your key results/findings; Second arrow—Discuss your results with their explanations\step by step; Third Arrow—Enumerate your studies limitations and strengths; Last arrow—Suggest future directions for investigation

4 Discussion Is Not a War of Words

5 How Long Should the Discussion in the Manuscript Be?

Most journals do not mention any limits for discussion as long as it is brief and relevant (Fig. 21.2 ). As a rule, ‘The length of the discussion section should not exceed the sum of other parts-introduction, materials and methods, and results’. [ 3 ] In any good article, the discussion section is 3–4 pages, 6–7 paragraphs, or approximately 10 paragraphs, and 1000–1500 words [ 1 , 5 , 8 , 12 ].

Discussion pyramid

6 What Should Be Written in the Conclusion Section?

The conclusion is the last paragraph and has the carry-home message for the reader. It is the powerful and meaningful end piece of the script. It states what change has the paper made to science and it also contains recommendations for future studies.

7 Conclusions

Discussion is not a stand-alone section, it intertwines the objectives of the study with how and what was achieved.

The major results are described and compared with other studies.

The author’s own work is critically analysed in comparison with that of others.

The limitations and strengths of the study are highlighted.

Masic I. How to write an efficient discussion? Mediev Archaeol. 2018;72(4):306–7.

Google Scholar  

Bagga A. Discussion: the heart of the paper. Indian Pediatr. 2016;53(10):901–4.

CrossRef   Google Scholar  

Ghasemi A, Bahadoran Z, Mirmiran P, Hosseinpanah F, Shiva N, Zadeh-Vakili A. The principles of biomedical scientific writing: discussion. Int J Endocrinol Metab. 2019;17:e95415.

Zeiger M. Essentials of writing biomedical research papers. Canadian J Stud Discourse Writing. 2000;11:33–6.

Bavdekar SB. Writing the discussion section: describing the significance of the study findings. J Assoc Physicians India. 2015;63:40–2.

PubMed   Google Scholar  

Foote M. The proof of the pudding: how to report results and write a good discussion. Chest. 2009;135(3):866–8.

Alexandrov AV. How to write a research paper? Cerebrovasc Dis. 2004;18(2):135–8.

Annesley TM. The discussion section: your closing argument. Clin Chem. 2010;56(11):1671–4.

CrossRef   CAS   Google Scholar  

Ng KH, Peh WC. Writing the discussion. Singap Med J. 2009;50:458–60.

CAS   Google Scholar  

Coverdale JH, Roberts LW, Balon R, Beresin EV. Writing for academia: Getting your research into print: AMEE guide No. 74. Med Teach. 2013;35:e926–34.

Araujo CG. Detailing the writing of scientific manuscripts: 25–30 paragraphs. Arq Bras Cardiol. 2014;102(2):e21–3.

PubMed   PubMed Central   Google Scholar  

Kearney MH. The discussion section tells us where we are. Res Nurs Health. 2017;40(4):289–91.

Download references

Author information

Authors and affiliations.

Department of Surgical Gastroenterology and Liver Transplantation, Sir Ganga Ram Hospital, New Delhi, India

Samiran Nundy

Department of Internal Medicine, Sir Ganga Ram Hospital, New Delhi, India

Institute for Global Health and Development, The Aga Khan University, South Central Asia, East Africa and United Kingdom, Karachi, Pakistan

Zulfiqar A. Bhutta

You can also search for this author in PubMed   Google Scholar

Rights and permissions

Open Access This chapter is licensed under the terms of the Creative Commons Attribution 4.0 International License ( http://creativecommons.org/licenses/by/4.0/ ), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made.

The images or other third party material in this chapter are included in the chapter's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the chapter's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

Reprints and Permissions

Copyright information

© 2022 The Author(s)

About this chapter

Cite this chapter.

Nundy, S., Kakar, A., Bhutta, Z.A. (2022). How to Write the Discussion?. In: How to Practice Academic Medicine and Publish from Developing Countries?. Springer, Singapore. https://doi.org/10.1007/978-981-16-5248-6_21

Download citation

DOI : https://doi.org/10.1007/978-981-16-5248-6_21

Published : 24 October 2021

Publisher Name : Springer, Singapore

Print ISBN : 978-981-16-5247-9

Online ISBN : 978-981-16-5248-6

eBook Packages : Medicine Medicine (R0)

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Find a journal
• Publish with us

Frequently asked questions

What’s the difference between the discussion and the conclusion.

In a thesis or dissertation, the discussion is an in-depth exploration of the results, going into detail about the meaning of your findings and citing relevant sources to put them in context.

The conclusion is more shorter and more general: it concisely answers your main research question and makes recommendations based on your overall findings.

Frequently asked questions: Dissertation

Dissertation word counts vary widely across different fields, institutions, and levels of education:

• An undergraduate dissertation is typically 8,000–15,000 words
• A master’s dissertation is typically 12,000–50,000 words
• A PhD thesis is typically book-length: 70,000–100,000 words

However, none of these are strict guidelines – your word count may be lower or higher than the numbers stated here. Always check the guidelines provided by your university to determine how long your own dissertation should be.

A dissertation prospectus or proposal describes what or who you plan to research for your dissertation. It delves into why, when, where, and how you will do your research, as well as helps you choose a type of research to pursue. You should also determine whether you plan to pursue qualitative or quantitative methods and what your research design will look like.

It should outline all of the decisions you have taken about your project, from your dissertation topic to your hypotheses and research objectives , ready to be approved by your supervisor or committee.

Note that some departments require a defense component, where you present your prospectus to your committee orally.

A thesis is typically written by students finishing up a bachelor’s or Master’s degree. Some educational institutions, particularly in the liberal arts, have mandatory theses, but they are often not mandatory to graduate from bachelor’s degrees. It is more common for a thesis to be a graduation requirement from a Master’s degree.

Even if not mandatory, you may want to consider writing a thesis if you:

• Plan to attend graduate school soon
• Have a particular topic you’d like to study more in-depth
• Are considering a career in research
• Would like a capstone experience to tie up your academic experience

The conclusion of your thesis or dissertation should include the following:

• A restatement of your research question
• A summary of your key arguments and/or results
• A short discussion of the implications of your research

The conclusion of your thesis or dissertation shouldn’t take up more than 5–7% of your overall word count.

For a stronger dissertation conclusion , avoid including:

• Important evidence or analysis that wasn’t mentioned in the discussion section and results section
• Generic concluding phrases (e.g. “In conclusion …”)
• Weak statements that undermine your argument (e.g., “There are good points on both sides of this issue.”)

Your conclusion should leave the reader with a strong, decisive impression of your work.

While it may be tempting to present new arguments or evidence in your thesis or disseration conclusion , especially if you have a particularly striking argument you’d like to finish your analysis with, you shouldn’t. Theses and dissertations follow a more formal structure than this.

All your findings and arguments should be presented in the body of the text (more specifically in the discussion section and results section .) The conclusion is meant to summarize and reflect on the evidence and arguments you have already presented, not introduce new ones.

A theoretical framework can sometimes be integrated into a  literature review chapter , but it can also be included as its own chapter or section in your dissertation . As a rule of thumb, if your research involves dealing with a lot of complex theories, it’s a good idea to include a separate theoretical framework chapter.

A literature review and a theoretical framework are not the same thing and cannot be used interchangeably. While a theoretical framework describes the theoretical underpinnings of your work, a literature review critically evaluates existing research relating to your topic. You’ll likely need both in your dissertation .

While a theoretical framework describes the theoretical underpinnings of your work based on existing research, a conceptual framework allows you to draw your own conclusions, mapping out the variables you may use in your study and the interplay between them.

A thesis or dissertation outline is one of the most critical first steps in your writing process. It helps you to lay out and organize your ideas and can provide you with a roadmap for deciding what kind of research you’d like to undertake.

Generally, an outline contains information on the different sections included in your thesis or dissertation , such as:

• Your anticipated title
• Your abstract
• Your chapters (sometimes subdivided into further topics like literature review , research methods , avenues for future research, etc.)

When you mention different chapters within your text, it’s considered best to use Roman numerals for most citation styles. However, the most important thing here is to remain consistent whenever using numbers in your dissertation .

In most styles, the title page is used purely to provide information and doesn’t include any images. Ask your supervisor if you are allowed to include an image on the title page before doing so. If you do decide to include one, make sure to check whether you need permission from the creator of the image.

Include a note directly beneath the image acknowledging where it comes from, beginning with the word “ Note .” (italicized and followed by a period). Include a citation and copyright attribution . Don’t title, number, or label the image as a figure , since it doesn’t appear in your main text.

Definitional terms often fall into the category of common knowledge , meaning that they don’t necessarily have to be cited. This guidance can apply to your thesis or dissertation glossary as well.

However, if you’d prefer to cite your sources , you can follow guidance for citing dictionary entries in MLA or APA style for your glossary.

A glossary is a collection of words pertaining to a specific topic. In your thesis or dissertation, it’s a list of all terms you used that may not immediately be obvious to your reader. In contrast, an index is a list of the contents of your work organized by page number.

The title page of your thesis or dissertation goes first, before all other content or lists that you may choose to include.

The title page of your thesis or dissertation should include your name, department, institution, degree program, and submission date.

Glossaries are not mandatory, but if you use a lot of technical or field-specific terms, it may improve readability to add one to your thesis or dissertation. Your educational institution may also require them, so be sure to check their specific guidelines.

A glossary or “glossary of terms” is a collection of words pertaining to a specific topic. In your thesis or dissertation, it’s a list of all terms you used that may not immediately be obvious to your reader. Your glossary only needs to include terms that your reader may not be familiar with, and is intended to enhance their understanding of your work.

A glossary is a collection of words pertaining to a specific topic. In your thesis or dissertation, it’s a list of all terms you used that may not immediately be obvious to your reader. In contrast, dictionaries are more general collections of words.

An abbreviation is a shortened version of an existing word, such as Dr. for Doctor. In contrast, an acronym uses the first letter of each word to create a wholly new word, such as UNESCO (an acronym for the United Nations Educational, Scientific and Cultural Organization).

As a rule of thumb, write the explanation in full the first time you use an acronym or abbreviation. You can then proceed with the shortened version. However, if the abbreviation is very common (like PC, USA, or DNA), then you can use the abbreviated version from the get-go.

Be sure to add each abbreviation in your list of abbreviations !

If you only used a few abbreviations in your thesis or dissertation , you don’t necessarily need to include a list of abbreviations .

If your abbreviations are numerous, or if you think they won’t be known to your audience, it’s never a bad idea to add one. They can also improve readability, minimizing confusion about abbreviations unfamiliar to your reader.

A list of abbreviations is a list of all the abbreviations that you used in your thesis or dissertation. It should appear at the beginning of your document, with items in alphabetical order, just after your table of contents .

Your list of tables and figures should go directly after your table of contents in your thesis or dissertation.

Lists of figures and tables are often not required, and aren’t particularly common. They specifically aren’t required for APA-Style, though you should be careful to follow their other guidelines for figures and tables .

If you have many figures and tables in your thesis or dissertation, include one may help you stay organized. Your educational institution may require them, so be sure to check their guidelines.

A list of figures and tables compiles all of the figures and tables that you used in your thesis or dissertation and displays them with the page number where they can be found.

The table of contents in a thesis or dissertation always goes between your abstract and your introduction .

You may acknowledge God in your dissertation acknowledgements , but be sure to follow academic convention by also thanking the members of academia, as well as family, colleagues, and friends who helped you.

A literature review is a survey of credible sources on a topic, often used in dissertations , theses, and research papers . Literature reviews give an overview of knowledge on a subject, helping you identify relevant theories and methods, as well as gaps in existing research. Literature reviews are set up similarly to other  academic texts , with an introduction , a main body, and a conclusion .

An  annotated bibliography is a list of  source references that has a short description (called an annotation ) for each of the sources. It is often assigned as part of the research process for a  paper .  

In the discussion , you explore the meaning and relevance of your research results , explaining how they fit with existing research and theory. Discuss:

• Your  interpretations : what do the results tell us?
• The  implications : why do the results matter?
• The  limitation s : what can’t the results tell us?

The results chapter or section simply and objectively reports what you found, without speculating on why you found these results. The discussion interprets the meaning of the results, puts them in context, and explains why they matter.

In qualitative research , results and discussion are sometimes combined. But in quantitative research , it’s considered important to separate the objective results from your interpretation of them.

Results are usually written in the past tense , because they are describing the outcome of completed actions.

The results chapter of a thesis or dissertation presents your research results concisely and objectively.

In quantitative research , for each question or hypothesis , state:

• The type of analysis used
• Relevant results in the form of descriptive and inferential statistics
• Whether or not the alternative hypothesis was supported

In qualitative research , for each question or theme, describe:

• Recurring patterns
• Significant or representative individual responses
• Relevant quotations from the data

Don’t interpret or speculate in the results chapter.

To automatically insert a table of contents in Microsoft Word, follow these steps:

• Apply heading styles throughout the document.
• In the references section in the ribbon, locate the Table of Contents group.
• Click the arrow next to the Table of Contents icon and select Custom Table of Contents.
• Select which levels of headings you would like to include in the table of contents.

Make sure to update your table of contents if you move text or change headings. To update, simply right click and select Update Field.

All level 1 and 2 headings should be included in your table of contents . That means the titles of your chapters and the main sections within them.

The contents should also include all appendices and the lists of tables and figures, if applicable, as well as your reference list .

Do not include the acknowledgements or abstract in the table of contents.

The abstract appears on its own page in the thesis or dissertation , after the title page and acknowledgements but before the table of contents .

An abstract for a thesis or dissertation is usually around 200–300 words. There’s often a strict word limit, so make sure to check your university’s requirements.

In a thesis or dissertation, the acknowledgements should usually be no longer than one page. There is no minimum length.

The acknowledgements are generally included at the very beginning of your thesis , directly after the title page and before the abstract .

Yes, it’s important to thank your supervisor(s) in the acknowledgements section of your thesis or dissertation .

Even if you feel your supervisor did not contribute greatly to the final product, you must acknowledge them, if only for a very brief thank you. If you do not include your supervisor, it may be seen as a snub.

In the acknowledgements of your thesis or dissertation, you should first thank those who helped you academically or professionally, such as your supervisor, funders, and other academics.

Then you can include personal thanks to friends, family members, or anyone else who supported you during the process.

Ask our team

Want to contact us directly? No problem.  We  are always here for you.

• Email [email protected]
• Start live chat
• Call +1 (510) 822-8066
• WhatsApp +31 20 261 6040

Our team helps students graduate by offering:

• A world-class citation generator
• Plagiarism Checker software powered by Turnitin
• Innovative Citation Checker software
• Professional proofreading services
• Over 300 helpful articles about academic writing, citing sources, plagiarism, and more

Scribbr specializes in editing study-related documents . We proofread:

• PhD dissertations
• Research proposals
• Personal statements
• Admission essays
• Motivation letters
• Reflection papers
• Journal articles
• Capstone projects

The Scribbr Plagiarism Checker is powered by elements of Turnitin’s Similarity Checker , namely the plagiarism detection software and the Internet Archive and Premium Scholarly Publications content databases .

The Scribbr Citation Generator is developed using the open-source Citation Style Language (CSL) project and Frank Bennett’s citeproc-js . It’s the same technology used by dozens of other popular citation tools, including Mendeley and Zotero.

You can find all the citation styles and locales used in the Scribbr Citation Generator in our publicly accessible repository on Github .

Custom Essay, Term Paper & Research paper writing services

• testimonials

Toll Free: +1 (888) 354-4744

Email: [email protected]

Writing custom essays & research papers since 2008

Writing a discussion section of research paper.

Are you struggling to write your first research paper? Congratulations! Doing it all by yourself won’t be easy, but you will quickly get the hang of it. Subsequent papers will be a lot easier to write. However, the first research paper always proves to be difficult. You don’t have extensive experience with academic writing, so you may be wondering how to write various sections of it.

The discussion section of research paper is one of the most difficult sections of the essay. This is why we will do our best to explain what it is, what it is there for, and how to write it. We will help you write the research paper discussion section in just one hour – or less. Read on!

The Importance of Discussion in a Research Paper

The role of a discussion in research paper may not be evident from the start. After all, most students think that the main purpose of the essay is to conduct research and present the findings. Unfortunately, it is not that simple. You need to also be able to discuss your findings and draw the appropriate conclusions. Your professor wants to see that you’ve understood the research methods and know how to analyze the results.

Simply presenting a list of results won’t be enough, obviously. This is precisely why you need a discussion in a research paper. And remember, the research paper discussion will be under intense scrutiny by your professor. It weighs heavily on the final grade, so be very careful how you write it.

So, What Goes in the Discussion Section of a Research Paper?

By now, you are probably interested to learn what goes in the discussion section of a research paper. Our academic writers have offered us some insight into this complicated section of the essay. Most often, the discussion section is made up of several paragraphs, each one dealing with an important finding. You will basically be analyzing the underlying meaning of your research. You will try to prove that your research and findings are of great help to the scientific community; that they fill gaps in knowledge. Here is what the discussion section should include:

• An explanation of the results. You should make it clear to your audience whether the results were expected or unexpected. In case of unexpected (or very important results), discuss your findings in greater detail. Make sure you note any important patterns or information that you came across during the research phase.
• Previous research. Of course, the discussion part of research paper should take into consideration previous research. Try to link your results to other studies and, when possible, show the gaps in knowledge that your own work can fill. The literature review section already contains the studies you should discuss.
• The deduction. How can the results of your study be applied generally? Do you have some recommendations to improve some best practices? Or perhaps you can suggest a way to improve a certain condition or situation. Bottom line, you need to show your readers how your research can help the scientific community.
• The research hypothesis . You can include a hypothesis (a possible conclusion or a more general claim) in the discussion section in a research paper. Keep in mind that the hypothesis can be disproved by subsequent research papers.

How to Write a Discussion Section of a Research Paper

The things that can go into the discussion section of a research paper we have listed above can be used in any order you wish. You can start with the hypothesis, if you want to. However, you should be very careful to remain objective while you discuss your findings. We know that you need to support your thesis, but sometimes the results of your research simply disprove it. The discussion section of research paper should discuss accurate results and data, even if you don’t like the outcome of your study.

We realize you probably want to learn how to start the discussion section of a research paper right away. You don’t have much time at your disposal, after all. Here are the basic steps you need to take to write this section as fast as possible:

• We’ll assume you’ve done the research yourself and then wrote the paper. In case you’ve taken data from an original discussion section of a research paper example (like the ones you can get from our amazing team of writers), you should read the paper from start to finish at least twice.
• Summarize all of your most important findings. This should take just one paragraph, so be very concise and stick to the point. You don’t need to repeat all your findings.
• Interpret the results. If you want to learn how to write the discussion section of a research paper, you need to be able to analyze data. Even though you know what the data means, your readers don’t. Explain why it is significant and how. Are there any patterns in the data? Were your findings expected? Are there any other explanations for the results?
• Identify the implications and discuss them. You should link your findings to the other studies that you have listed in the Literature Review section. What does your data prove? How does it fill a gap in knowledge? Did your work disprove the hypothesis of another research paper?
• A key part of learning how to write a discussion section of a research paper is accepting the limitations. You need to acknowledge the limitations of your research and present them in an objective way. Were there variables you were unable to control? Was the sample size too small? Were there any problems with data gathering or analysis?
• Make the appropriate recommendations. The discussion and conclusion in research paper are not that different, so you need to end the Discussion section with some recommendations. Is there a need for future research? Does a situation or best practice need to be changed? State your recommendations clearly.

Get A Discussion Section of a Research Paper Example

Writing the discussion section shouldn’t be difficult. The advice you’re received above – as well as the guide – should help you write the section in less than one hour. However, we realize you need something more palpable. You need an excellent discussion section of a research paper example. By reading a well-written sample, you can understand how the writer discussed his or her findings. The problem is that finding a great example of discussion in research paper is not as easy as it sounds.

The Internet is full of badly written Discussion sections. An example of a discussion research paper writers would use is hard to come by. Get in touch with our seasoned academic writers if you need such a sample. They will gladly send you a well-written and well-organized example. And since the sample will be written just for you, it will be 100% original. In addition, our team of academics can show you how to write results and discussion in a research paper quickly for a top grade. You can rely on us for quick help.

Discussion section of a research paper

When writing a research paper, this is one of the most important part of a research paper.

The discussion section of a research paper is where you interpret the data and present your conclusions. In this section, you should discuss how your results relate to the hypotheses you proposed and what they mean for future research. You should also point out any limitations of your study and suggest ways that the findings could be further developed. Finally, you should briefly summarize the main points of your paper.

In many research papers, the discussion and conclusion sections usually overlap. However, it is still important to keep them separate so that your paper is organized and easy to follow.

• How to write the results section of a research paper + examples

Exploratory data analysis research paper

• How to write a school shooting research paper, outline examples
• Research Analysis Paper: How to Analyze a Research Article

Types of research papers

Data analysis section of a research paper.

What is the discussion section of a research paper?

The discussion section of a research paper is the section where the author discusses the findings of the study and how they relate to the existing body of knowledge on the topic.

The purpose of the discussion section is to interpret the findings of your study, and to explain how they relate to the existing body of scientific knowledge. This is a critical part of any research paper, as it helps to illustrate the significance of your work, and how it may impact future research. Additionally, the discussion section can highlight potential limitations of your study, and offer suggestions for future research.

When writing the discussion section of a research paper, it is important to keep the following in mind:

• The discussion section should be concise and focus on the key points of your study.
• Be sure to interpret your findings in light of the existing body of knowledge.
• Offer suggestions for future research.
• Discuss the potential limitations of your study.
• Remain objective and unbiased in your discussion.
• Use clear and concise language.
• Make sure your arguments are logically sound.
• Cite your sources appropriately.

How to write the discussion section of a research paper

Writing a discussion part of any research paper is not easy. It is the place where you need to show your understanding of the subject and present your arguments. The following tips will help you write a strong discussion section:

Summarize your key findings:

Start the discussion section by summarizing your main findings in a few sentences. This will help remind the reader of what you found and how it relates to your argument.

Evaluate your findings:

After you’ve summarize your findings, it’s important to evaluate how strong they are. Were your results significant? Do they support your argument? Are there any potential problems with your data or methods? These are the types of questions you should answer in this section.

Contextualize your findings:

After you’ve evaluated your findings, it’s important to put them in context. What do your results mean? How do they compare to what other scholars have found? How does your research contribute to the existing conversation on this topic? These are the types of questions you should answer in this section. Give your interpretation of what the findings mean. What do they suggest about the subject? Are there any implications for future research? Keep your writing clear and concise. Avoid over-explaining or going into too much detail. The goal is to help the reader understand your findings, not to teach them about the subject.

Show how your findings fit with what is already known about the topic. If there are differences, explain why they may exist.

Implications of your findings:

Finally, you’ll want to discuss the implications of your findings. What do they mean for your argument? For future research on this topic? For the world more broadly? What are the implications of your findings? What questions still need to be answered? These are the types of questions you should answer in this section.

Acknowledge the limitations:

Every study has limitations. Be honest about the limitations of your study and highlight any areas that need further research. Be critical and acknowledge the limitations of your study and highlight any areas that need further research. suggest ways in which future research could build on your findings.

In a research paper, limitations are usually found in the methodology section. However, it is also important to mention them in the discussion section as well. By acknowledging the limitations of your study, you show that you are aware of the potential for error and that you took steps to minimize it. This makes your research more credible.

To help illustrate the points made in this section, let’s look at a few examples.

Example 1: In a study on the effects of climate change on plant growth, the authors found that plants grown in warmer temperatures produced less biomass.

The results of this study suggest that climate change may have a negative effect on plant growth. However, there are some limitations to this study. First, the study was conducted in a controlled environment, so it is not clear if the results would be the same in the wild. Second, the study only looked at one aspect of plant growth (biomass production), so it is not clear if other aspects of plant growth would be affected by climate change. Third, the study did not take into account the effects of precipitation, which is also likely to play a role in plant growth.

Despite these limitations, the results of this study provide valuable insight into the potential effects of climate change on plant growth.

Example 2: In a study on the effectiveness of a new reading program, the authors found that students who used the program improved their reading scores.

The results of this study suggest that the reading program is effective. However, there are some limitations to this study. First, the sample size was small, so it is possible that the results are not representative of the population as a whole. Second, the study only looked at one measure of reading achievement (scores on a standardized test), so it is not clear if the program would have the same effect on other measures of reading achievement. Third, the study did not compare the students who used the program to a control group, so it is not clear if the improvement in reading scores was due to the program or to natural variation.

Despite these limitations, the results of this study provide valuable insight into the potential effectiveness of the reading program.

State your recommendations:

If appropriate, make recommendations for future research or practice. Recommendations could be based on your findings or on the limitations of your study.

Use the phrases to make recommendations:

• This study suggests that…
• Future research should…
• Further studies are needed to…
• This study has limitations that future research could address.
• The findings of this study have implications for…
• These findings suggest that policy makers should…

End with a strong conclusion:

End the discussion section with a brief conclusion that summarizes your findings and their significance. What are the implications of your findings? What questions still need to be answered? Leave the reader with a clear understanding of what you found and why it matters.

Your discussion section should be a critical evaluation of your findings, not just a summary. Remember to be clear, concise, and professional.

What to avoid in research paper discussion section

Here are 3 key items that you should avoid including when writing the discussion section of your research paper:

• Do not introduce new data or results : The discussion section is not the place to introduce new data.
• Avoid overstating your case : it is important to be honest and objective in your interpretation of the data. Do not try to force the data to fit your argument; instead, be willing to accept that it may not support your case.
• Avoid undermining your research : Be confident in your findings and avoid making statements that could undermine your study. For example, avoid phrases such as “this may not be generalizable” or “more research is needed.” These statements make it sound like you are unsure of your results.

What goes in the discussion section of a research paper?

The discussion section of a research paper is where you analyze your findings and interpret them. This section should be a critical evaluation of your findings, not just a summary. Remember to be clear, concise, and professional.

In the discussion section, you should:

• Introduce your findings and state the purpose of the study
• Discuss the results of the study
• Interpret the results of the study
• Discuss the limitations of the study
• Make recommendations for future research or practice
• Summarize your findings and their significance

Discussion section of a research paper example

Discussion template for research paper

The discussion section of a research paper includes 3 parts: an introductory paragraph, intermediate paragraphs and a conclusion paragraph . The introductory paragraph should provide a brief overview of the previous research that has been conducted on the topic. The intermediate paragraphs should present the findings of your study and how they compare or contrast with the findings of previous studies. The conclusion paragraph should summarize the main points of the discussion section and suggest possible future directions for research.

1. Start with a strong introduction. 2. Present your findings in a clear and concise manner. 3. Analyze your findings and offer your interpretation. 4. Summarize your discussion and offer concluding thoughts.

The discussion section is where you analyze your results and put them into context. You should discuss how your results compare to other studies, what they mean for the field of research, and how they can be applied to real-world problems. You should also highlight any weaknesses or limitations of your study so that future researchers can build on your work. Finally, you should suggest future directions for research based on your findings.

A discussion in research is section where the author discusses the results of the study and how it can be improved.

Author: tutlance

• How to write a research paper outline, examples, & template

Content analysis

How to write preface for project report, research paper on mass shootings in america, parts of a research paper, how to write an abstract for a lab report, related guides, how to conduct research for a research paper, what are research findings, research paper examples, what is an appendix in a paper, research analysis paper: how to analyze a research..., how to write a research proposal – topics,..., research paper title page, research paper format, how to write a school shooting research paper,..., how to write hypothesis in a research paper, how to write a meta analysis research paper, how to write a research paper abstract +..., research paper conclusion.

• Homework Help
• Online Tutors
• Essay Writing Services
• Do My Math Homework
• Assignment Help
• Take My Online Math Class
• Take My Exam
• Take My Test
• Take My Course
• Dissertation Services
• Essay Introduction
• Essay Thesis Statement
• Essay Hooks
• Essay Conclusion
• Essay Revision
• Essay Title
• Essay Format
• Essay Outline
• Essay Cover Page
• Essay Topics
• Classification Essay
• Analytical Essay
• Cause and Effect Essay
• Expository Essay
• Descriptive Essay
• Argumentative Essay
• Compare and Contrast Essay
• Definition essay
• Narrative essay
• Persuasive essay
• Reflective essay
• Literary analysis essay
• Proposal essay
• Process essay
• Reflection Paper
• Evaluation Essay
• Exemplification essay
• Illustration Essay
• Informative essay
• Rhetorical analysis essay
• Review essay
• Scholarship essay
• Dissertation
• Annotated Bibliography
• Research Paper
• Research Paper Topics
• Position Paper
• Speech Writing
• Summary Writing
• Story writing
• Swot Analysis
• Resume Writing
• Business Plan
• Grant Writing
• Book Writing
• Personal Statement
• Writing Process
• Research Process
• Online Tutoring Subjects
• Become a Tutor
• Forgot Password?

• Research Paper Guides
• Basics of Research Paper Writing

How to Write a Discussion Section: Writing Guide

• Speech Topics
• Basics of Essay Writing
• Essay Topics
• Other Essays
• Main Academic Essays
• Research Paper Topics
• Miscellaneous
• Chicago/ Turabian
• Data & Statistics
• Methodology
• Admission Writing Tips
• Admission Advice
• Other Guides
• Student Life
• Studying Tips
• Understanding Plagiarism
• Academic Writing Tips
• Basics of Dissertation & Thesis Writing

• Essay Guides
• Formatting Guides
• Basics of Research Process
• Admission Guides
• Dissertation & Thesis Guides

Table of contents

Use our free Readability checker

The discussion section of a research paper is where the author analyzes and explains the importance of the study's results. It presents the conclusions drawn from the study, compares them to previous research, and addresses any potential limitations or weaknesses. The discussion section should also suggest areas for future research.

Everything is not that complicated if you know where to find the required information. We’ll tell you everything there is to know about writing your discussion. Our easy guide covers all important bits, including research questions and your research results. Do you know how all enumerated events are connected? Well, you will after reading this guide we’ve prepared for you!

What Is in the Discussion Section of a Research Paper

The discussion section of a research paper can be viewed as something similar to the conclusion of your paper. But not literal, of course. It’s an ultimate section where you can talk about the findings of your study. Think about these questions when writing:

• Did you answer all of the promised research questions?
• Did you mention why your work matters?
• What are your findings, and why should anyone even care?
• Does your study have a literature review?

So, answer your questions, provide proof, and don’t forget about your promises from the introduction. 

How to Write a Discussion Section in 5 Steps

How to write the discussion section of a research paper is something everyone googles eventually. It's just life. But why not make everything easier? In brief, this section we’re talking about must include all following parts:

• Answers for research questions
• Literature review
• Results of the work
• Limitations of one’s study
• Overall conclusion

Indeed, all those parts may confuse anyone. So by looking at our guide, you'll save yourself some hassle.  P.S. All our steps are easy and explained in detail! But if you are looking for the most efficient solution, consider using professional help. Leave your “ write my research paper for me ” order at StudyCrumb and get a customized study tailored to your requirements.

Step 1. Start Strong: Discussion Section of a Research Paper

First and foremost, how to start the discussion section of a research paper? Here’s what you should definitely consider before settling down to start writing:

• All essays or papers must begin strong. All readers will not wait for any writer to get to the point. We advise summarizing the paper's main findings.
• Moreover, you should relate both discussion and literature review to what you have discovered. Mentioning that would be a plus too.
• Make sure that an introduction or start per se is clear and concise. Word count might be needed for school. But any paper should be understandable and not too diluted.

Step 2. Answer the Questions in Your Discussion Section of a Research Paper

Writing the discussion section of a research paper also involves mentioning your questions. Remember that in your introduction, you have promised your readers to answer certain questions. Well, now it’s a perfect time to finally give the awaited answer. You need to explain all possible correlations between your findings, research questions, and literature proposed. You already had hypotheses. So were they correct, or maybe you want to propose certain corrections? Section’s main goal is to avoid open ends. It’s not a story or a fairytale with an intriguing ending. If you have several questions, you must answer them. As simple as that.

Step 3. Relate Your Results in a Discussion Section

Writing a discussion section of a research paper also requires any writer to explain their results. You will undoubtedly include an impactful literature review. However, your readers should not just try and struggle with understanding what are some specific relationships behind previous studies and your results.  Your results should sound something like: “This guy in their paper discovered that apples are green. Nevertheless, I have proven via experimentation and research that apples are actually red.” Please, don’t take these results directly. It’s just an initial hypothesis. But what you should definitely remember is any practical implications of your study. Why does it matter and how can anyone use it? That’s the most crucial question.

Step 4. Describe the Limitations in Your Discussion Section

Discussion section of a research paper isn’t limitless. What does that mean? Essentially, it means that you also have to discuss any limitations of your study. Maybe you had some methodological inconsistencies. Possibly, there are no particular theories or not enough information for you to be entirely confident in one’s conclusions.  You might say that an available source of literature you have studied does not focus on one’s issue. That’s why one’s main limitation is theoretical. However, keep in mind that your limitations must possess a certain degree of relevancy. You can just say that you haven’t found enough books. Your information must be truthful to research.

Step 5. Conclude Your Discussion Section With Recommendations

Your last step when you write a discussion section in a paper is its conclusion, like in any other academic work. Writer’s conclusion must be as strong as their starting point of the overall work. Check out our brief list of things to know about the conclusion in research paper :

• It must present its scientific relevance and importance of your work.
• It should include different implications of your research.
• It should not, however, discuss anything new or things that you have not mentioned before.
• Leave no open questions and carefully complete the work without them.

Discussion Section of a Research Paper Example

All the best example discussion sections of a research paper will be written according to our brief guide. Don’t forget that you need to state your findings and underline the importance of your work. An undoubtedly big part of one’s discussion will definitely be answering and explaining the research questions. In other words, you’ll already have all the knowledge you have so carefully gathered. Our last step for you is to recollect and wrap up your paper. But we’re sure you’ll succeed!

How to Write a Discussion Section: Final Thoughts

Today we have covered how to write a discussion section. That was quite a brief journey, wasn’t it? Just to remind you to focus on these things:

• Importance of your study.
• Summary of the information you have gathered.
• Main findings and conclusions.
• Answers to all research questions without an open end.
• Correlation between literature review and your results.

But, wait, this guide is not the only thing we can do. Looking for how to write an abstract for a research paper  for example? We have such a blog and much more on our platform.

Our academic writing service is just a click away. We are proud to say that our writers are professionals in their fields. Buy a research paper and our experts can provide prompt solutions without compromising the quality.

Discussion Section of a Research Paper: Frequently Asked Questions

1. how long should the discussion section of a research paper be.

Our discussion section of a research paper should not be longer than other sections. So try to keep it short but as informative as possible. It usually contains around 6-7 paragraphs in length. It is enough to briefly summarize all the important data and not to drag it.

2. What's the difference between the discussion and the results?

The difference between discussion and results is very simple and easy to understand. The results only report your main findings. You stated what you have found and how you have done that. In contrast, one’s discussion mentions your findings and explains how they relate to other literature, research questions, and one’s hypothesis. Therefore, it is not only a report but an efficient as well as proper explanation.

3. What's the difference between a discussion and a conclusion?

The difference between discussion and conclusion is also quite easy. Conclusion is a brief summary of all the findings and results. Still, our favorite discussion section interprets and explains your main results. It is an important but more lengthy and wordy part. Besides, it uses extra literature for references.

4. What is the purpose of the discussion section?

The primary purpose of a discussion section is to interpret and describe all your interesting findings. Therefore, you should state what you have learned, whether your hypothesis was correct and how your results can be explained using other sources. If this section is clear to readers, our congratulations as you have succeeded.

Joe Eckel is an expert on Dissertations writing. He makes sure that each student gets precious insights on composing A-grade academic writing.

You may also like

Research Discussion – Objectives, Importance, Basic Rules, and Techniques

Published 16 October, 2023

The discussion chapter is where you will explain the meaning and importance of your results. It should focus on explaining what you found, relating it to anything from your literature review or research questions, and making an argument for why this conclusion makes more sense than any other one.

It should focus on explaining how it relates to what was found in previous studies and show that there are conclusions drawn from this work. The author will argue for their thesis statement which may be an extension or modification of the original research question proposed earlier in order to discuss a new perspective about its significance with respect to other topics covered by related literature reviews.

Objectives of Research Discussion

Discussion in the context of research means an in-depth analysis of the argument in order to reach the research conclusion .

• The main objective of the discussion section in the research paper is to provide interpretation and demonstration of the importance of research findings .
• In addition to this, another purpose of the discussion section in the academic paper is to discover the hidden aspect of the issue on which you are performing research. It intends to help the researcher in demonstrating the way findings drawn from the research which you are performing will help the reader in increasing their knowledge about specific problems.

Importance of discussion in research paper 

The discussion section in the research section has great significance :

• It is the section in a research paper that enables you to showcase your critical thinking skills. As the discussion is the section in a research paper where you need to critically think about the problem and provide a unique solution for the same.
• Discussion enables you to explain the meaning and purpose of the investigation. It is through discussion you by providing evidence can demonstrate the signification of the problem.
• This section in the research paper further allows you to analyze the further scope of improvement in the research process .
• Through writing a discussion paper, you can easily demonstrate the way findings or conclusions drawn from the investigation which you are performing on a specific topic will help in filling the knowledge gap.
• By writing a good discussion in academic papers you can easily encourage the reader to critically think about the problem.

The basic rules of writing discussion in a research paper

The basic rules which you should follow while writing a discussion section in a research paper are:

• You should try to avoid repetition of sentences
• You need to state your opinion clearly.
• Avoid the utilization of technical words or sentences.
• First, you should provide interpretation and then have a logical about the same in a research paper.
• The subheadings which you can use for organizing the discussion in a systematic manner. In addition to this, you can use themes for presenting your findings in a systematic manner. The use of themes for presenting information will help you to make reports presentable and easily understandable by the reader.

Read Also: Overview of Relevance in Research

Techniques of writing discussion in research paper

You should include the following in the discussion section of the research paper:

• Explain outcome: While writing the discussion section you need to clearly state whether you have expected the same outcome or findings or not. In addition to the academic paper, you should include the detail about the unique trends which you have analyzed.
• References of existing investigation: Here, you need to make a comparison of your research findings with the investigation performed by other researchers on the same topic or subject. It is a technique that which you can apply for supporting the claim. You need to review the sources from where you have gathered the information for writing the literature review in research paper . You can utilize the references for showing the investigations which already have been conducted earlier on the same topic in the discussion section.
• Application of research: In the discussion section, you can share your experience of learning through participating in an investigation. In addition to this, you can state the skills and knowledge which you have developed by participating in research. You can give some suggestions or advice for improving situations. For instance,  I have gain knowledge about new concepts and developed an understanding of the theories related to globalization. Another example: the study you can easily design a new theory out of it which you can include in the discussion section.
• Hypothesis: A more general claim or hypothetical conclusion based on the findings [that may or may not be proven or disproved in the subsequent study]. This can be expressed as new research questions that have arisen as a result of your investigation.

Stuck During Your Dissertation

Our top dissertation writing experts are waiting 24/7 to assist you with your university project,from critical literature reviews to a complete PhD dissertation.

Other Related Guides

• Research Project Questions
• Types of Validity in Research – Explained With Examples
• Schizophrenia Sample Research Paper
• Quantitative Research Methods – Definitive Guide
• Research Paper On Homelessness For College Students
• How to Study for Biology Final Examination
• Textual Analysis in Research / Methods of Analyzing Text

A Guide to Start Research Process – Introduction, Procedure and Tips

Research findings – objectives , importance and techniques.

• Topic Sentences in Research Paper – Meaning, Parts, Importance, Procedure and Techniques

Recent Research Guides for 2023

Get 15% off your first order with My Research Topics

Connect with a professional writer within minutes by placing your first order. No matter the subject, difficulty, academic level or document type, our writers have the skills to complete it.

My Research Topics is provides assistance since 2004 to Research Students Globally. We help PhD, Psyd, MD, Mphil, Undergrad, High school, College, Masters students to compete their research paper & Dissertations. Our Step by step mentorship helps students to understand the research paper making process.

Research Topics & Ideas

• Sociological Research Paper Topics & Ideas For Students 2023
• Nurses Research Paper Topics & Ideas 2023
• Nursing Capstone Project Research Topics & Ideas 2023
• Unique Research Paper Topics & Ideas For Students 2023
• Teaching Research Paper Topics & Ideas 2023
• Literary Research Paper Topics & Ideas 2023
• Nursing Ethics Research Topics & Ideas 2023

Research Guide

Disclaimer: The Reference papers provided by the Myresearchtopics.com serve as model and sample papers for students and are not to be submitted as it is. These papers are intended to be used for reference and research purposes only.

Discussion papers and briefings

Beyond income: redrawing asia’s consumer map, could climate become the weak link in your supply chain, reduced dividends on natural capital, the future of work in europe, the future of asia: decoding the value and performance of corporate asia, a mediterranean basin without a mediterranean climate, how will african farmers adjust to changing patterns of precipitation, will the world’s breadbaskets become less reliable, will mortgages and markets stay afloat in florida, can coastal cities turn the tide on rising flood risk, lives and livelihoods: assessing the near-term impact of covid-19 on us workers, connected world: an evolution in connectivity beyond the 5g revolution, reviving innovation in europe, the future of asia: asian flows and networks are defining the next phase of globalization, inequality: a persisting challenge and its implications, the future of women at work in the united kingdom, artificial intelligence in the united kingdom: prospects and challenges, tackling bias in artificial intelligence (and in humans), a new look at the declining labor share of income in the united states, twenty-five years of digitization: ten insights into how to play it right, ‘tech for good’: using technology to smooth disruption and improve well-being, tackling europe’s gap in digital and ai, navigating a world of disruption, testing the resilience of europe’s inclusive growth model, applying artificial intelligence for social good, ‘superstars’: the dynamics of firms, sectors, and cities leading the global economy, the promise and challenge of the age of artificial intelligence, the power of parity: advancing gender equality in the dutch labor market, notes from the ai frontier: modeling the impact of ai on the world economy, solving the united kingdom’s productivity puzzle in a digital age, a decade after the global financial crisis: what has (and hasn’t) changed, smart cities in southeast asia, rising corporate debt: peril or promise, ai, automation, and the future of work: ten things to solve for, notes from the ai frontier: applications and value of deep learning, europe’s economy: three pathways to rebuilding trust and sustaining momentum, preparing brazil for the future of work: jobs, technology, and skills, bridging infrastructure gaps: has the world made progress, housing affordability: a supply-side tool kit for cities, 10 imperatives for europe in the age of ai and automation, china’s digital economy: a leading global force, how artificial intelligence can deliver real value to companies, a new emphasis on gainful employment in india, what’s now and next in analytics, ai, and automation, china’s role in the next phase of globalization, how to counter three threats to growth in latin america, new insights into the slowdown in us productivity growth, new priorities for the european union at 60, where companies with a long-term view outperform their peers, technology, jobs, and the future of work, can the us economy return to dynamic and inclusive growth, realizing gender equality’s $12 trillion economic opportunity, secular stagnation and low investment: breaking the vicious cycle—a discussion paper, qe and ultra-low interest rates: distributional effects and risks, how the world could better fight obesity, an exorbitant privilege implications of reserve currencies for competitiveness.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• My Account Login
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 13 November 2023

Senolytic therapy alleviates physiological human brain aging and COVID-19 neuropathology

• Julio Aguado   ORCID: orcid.org/0000-0002-1841-4741 1 ,
• Alberto A. Amarilla 2   na1 ,
• Atefeh Taherian Fard   ORCID: orcid.org/0000-0002-9126-4540 1 ,
• Eduardo A. Albornoz   ORCID: orcid.org/0000-0002-9976-6350 3 ,
• Alexander Tyshkovskiy   ORCID: orcid.org/0000-0002-6215-190X 4 , 5 ,
• Marius Schwabenland   ORCID: orcid.org/0000-0003-2205-5427 6 ,
• Harman K. Chaggar 1 ,
• Naphak Modhiran 1 , 2 ,
• Cecilia Gómez-Inclán 1 ,
• Ibrahim Javed 1 , 7 ,
• Alireza A. Baradar 1 ,
• Benjamin Liang   ORCID: orcid.org/0000-0003-3304-4715 2 ,
• Lianli Peng   ORCID: orcid.org/0000-0002-8410-7336 1 ,
• Malindrie Dharmaratne 1 ,
• Giovanni Pietrogrande 1 ,
• Pranesh Padmanabhan   ORCID: orcid.org/0000-0001-5569-8731 8 ,
• Morgan E. Freney 2 ,
• Rhys Parry   ORCID: orcid.org/0000-0001-9238-1952 2 ,
• Julian D. J. Sng   ORCID: orcid.org/0000-0001-7837-4473 2 ,
• Ariel Isaacs 2 ,
• Alexander A. Khromykh 2 , 9 ,
• Guillermo Valenzuela Nieto 10 ,
• Alejandro Rojas-Fernandez 11 , 12 ,
• Thomas P. Davis   ORCID: orcid.org/0000-0003-2581-4986 1 ,
• Marco Prinz   ORCID: orcid.org/0000-0002-0349-1955 6 , 13 ,
• Bertram Bengsch   ORCID: orcid.org/0000-0003-2552-740X 13 , 14 ,
• Vadim N. Gladyshev   ORCID: orcid.org/0000-0002-0372-7016 4 , 15 ,
• Trent M. Woodruff   ORCID: orcid.org/0000-0003-1382-911X 3 ,
• Jessica C. Mar 1   na1 ,
• Daniel Watterson 2   na1 &
• Ernst J. Wolvetang   ORCID: orcid.org/0000-0002-2146-6614 1   na1  

Nature Aging ( 2023 ) Cite this article

11k Accesses

560 Altmetric

Metrics details

• Neural ageing

Aging is a major risk factor for neurodegenerative diseases, and coronavirus disease 2019 (COVID-19) is linked to severe neurological manifestations. Senescent cells contribute to brain aging, but the impact of virus-induced senescence on neuropathologies is unknown. Here we show that senescent cells accumulate in aged human brain organoids and that senolytics reduce age-related inflammation and rejuvenate transcriptomic aging clocks. In postmortem brains of patients with severe COVID-19 we observed increased senescent cell accumulation compared with age-matched controls. Exposure of human brain organoids to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) induced cellular senescence, and transcriptomic analysis revealed a unique SARS-CoV-2 inflammatory signature. Senolytic treatment of infected brain organoids blocked viral replication and prevented senescence in distinct neuronal populations. In human-ACE2-overexpressing mice, senolytics improved COVID-19 clinical outcomes, promoted dopaminergic neuron survival and alleviated viral and proinflammatory gene expression. Collectively our results demonstrate an important role for cellular senescence in driving brain aging and SARS-CoV-2-induced neuropathology, and a therapeutic benefit of senolytic treatments.

Although SARS-CoV-2 is primarily a respiratory viral pathogen and the cause of COVID-19, persistent postacute infection syndromes (PAISs) derived from viral infections including SARS-CoV-2 are emerging as a frequent clinical picture 1 , 2 . In fact most patients with COVID-19, including individuals with or without comorbidities and even asymptomatic patients, often experience a range of neurological complications 3 , 4 . ‘Long-COVID’ is a type of PAIS that is gaining notable awareness, with patients reporting persistent manifestations such as hyposmia, hypogeusia, sleep disorders and substantial cognitive impairment, the latter affecting approximately one in four COVID-19 cases 5 , 6 , 7 . These clinical symptoms are supported by ample evidence of SARS-CoV-2 infectivity in multiple cell types of the nervous system 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 and significant structural changes in the brains of patients with COVID-19 (ref. 17 ). Furthermore, patient transcriptomic data from postmortem brain tissue indicate associations between the cognitive decline observed in patients with severe COVID-19 and molecular signatures of brain aging 18 . In agreement with this observation, postmortem patient biopsies show that SARS-CoV-2-infected lungs accumulate markedly higher levels of senescence compared with uninfected counterparts 19 , a cellular phenotype known to contribute to both organismal aging 20 and comorbidities such as chronic degenerative conditions 21 . Importantly, while recent data support a role for senescent cells in driving neurodegeneration and cognitive decline in both in vivo models of neuropathology 22 , 23 and physiologically aged mice 24 , their contribution to COVID pathology in the central nervous system (CNS) and to human tissue brain aging remains unknown.

Over the past decade numerous strategies have been developed to target senescent cells 25 . Among these, the pharmacological removal of senescent cells with senolytic drugs has become one of the most explored interventions, with many currently in human clinical trials 26 . A group of these senolytics—such as the cocktail of dasatinib plus quercetin (D + Q) and fisetin—exhibit blood–brain barrier permeability following oral administration 22 , 27 , making these formulations particularly valuable for testing the contribution of senescence in the brain in vivo.

In the present study we first document the efficacy of multiple senolytic interventions in clearing senescent cells in physiologically aged human pluripotent stem cell (hPSC)-derived brain organoids (BOs). Transcriptomic analysis across individual senolytic treatments revealed a differential effect in modulating the senescence-associated secretory phenotype (SASP), with a distinctive impact of D + Q administration in rejuvenation of the BO transcriptomic aging clock. Importantly, we report an enrichment of senescent cells in postmortem brain tissue of patients with COVID-19 and further show a direct role for SARS-CoV-2 and highly neurotropic viruses such as Zika (ZIKV) and Japanese encephalitis (JEV) in evoking cellular senescence in human BOs. SARS-CoV-2 variant screening identified Delta (B.1.617.2) as the variant exerting the strongest induction of cellular senescence in human BOs, and spatial transcriptomic analysis of Delta-induced senescent cells unveiled a distinctive type of senescence that exhibits a transcriptional signature different from that of senescent cells that naturally emerge in in vitro aged uninfected BOs. Furthermore, senolytic treatment of SARS-CoV-2-infected BOs selectively removed senescent cells, lessened SASP-related inflammation and reduced SARS-CoV-2 RNA expression, indicating a putative role for senescent cells in facilitation of viral retention. Finally, to gain in vivo relevance of these findings, we examined the treatment effects of senolytic administration in transgenic mice expressing human angiotensin-converting enzyme 2 (hACE2) 8 and previously infected with SARS-CoV-2. Our in vivo experiments demonstrate that senolytics improved clinical performance and survival, reduced viral load in the brain, improved survival of dopaminergic neurons, decreased astrogliosis and attenuated senescence and SASP gene expression in the brains of infected mice. Our findings therefore suggest a detrimental role for virus-induced senescence in acceleration of brain inflammation and the aging process in the CNS, and a potential therapeutic role for senolytics in the treatment of COVID-19 neuropathology.

Senolytics target biological aging and senescence in physiologically aged human BOs

To model the efficacy of senolytics in clearing senescent cells from human brain tissue models, we generated human BOs from embryonic stem cells. We next physiologically aged these for a period of 8 months because, at this timepoint, senescence accumulation reaches an exponential phase (Extended Data Fig. 1a ) and therefore constitutes the optimal time-window for investigation of the impact of senolytics. At this stage we exposed BOs to two doses of senolytics for 1 month at 2-weekly intervals (Extended Data Fig. 1b ). We tested the Bcl-2 inhibitors navitoclax and ABT-737, as well as the D + Q senolytic drug combination, and quantified the abundance of cells exhibiting senescence-associated β-galactosidase (SA-β-gal) activity. Exposure to senolytics resulted in significantly lower SA-β-gal activity compared with vehicle-treated controls (Fig. 1a,c ), indicating that all treatments had eliminated a large number of senescent cells in treated BOs. In agreement with this, analysis of the expression of lamin B1 protein, a nuclear lamina marker often downregulated in senescence 28 , within organoid sections revealed a significantly higher content of lamin B1 in senolytic-treated organoids compared with control counterparts (Fig. 1b,d ), further indicating that senolytics had cleared senescent cells by enrichment for lamin B1 High cell populations. We next interrogated the brain cell types responsible for senescence phenotypes by coimmunolabeling with p16 senescence marker. Notably we found that >75% of cells positive for p16 coimmunostained with astrocytes (glial fibrillary acidic protein (GFAP)-positive cells) whereas ~15% colocalized with mature neurons positive for NeuN antigen (Fig. 1e,f ), with these populations of brain cells accounting for >90% of p16-positive cells. Importantly, senolytic interventions exerted a significant impact on reducing the population of senescent astrocytes, where the combination of D + Q exhibited the most potent effect (Fig. 1e,f and Extended Data Fig. 1c ). The impact of senolytics on reduction of senescent neurons was less evident, where navitoclax failed to show a significant difference compared with vehicle-treated organoids, while D + Q exerted the most significant effect in alleviation of cellular senescence in neurons across all interventions tested (Extended Data Fig. 1c ).

a – f , BOs were generated and grown in vitro for 8 months and subsequently exposed to two doses (one every 2 weeks) of either navitoclax (2.5 μM), ABT-737 (10 μM) or D + Q (D, 10 μM; Q, 25 μM) within the following month, after which organoids ( n  = 8–14) were collected for in situ analysis. a , SA-β-gal assay was performed on organoid sections. Each data point in the bar graph represents a single organoid analyzed. Data presented as mean ± s.d.; at least eight individual organoids were analyzed per condition; one-way analysis of variance (ANOVA) with Tukey’s multiple-comparison post hoc corrections. b , Lamin B1 staining was performed on organoid sections. Each data point in the scatter plot represents the integrated intensity of each cell within organoid sections. At least eight individual organoids were analyzed per condition; one-way ANOVA with Tukey’s multiple-comparison post hoc corrections. c , d , Representative images from quantifications shown in a , b , respectively. Scale bar, 0.3 mm. e , Representative immunofluorescent images of regions from organoids treated with the indicated senolytics and vehicle control. Samples were individually immunolabeled with antibodies against GFAP, Sox2 and NeuN and co-stained for p16. Arrows indicate coimmunoreactivity of NeuN and p16. Scale bar, 50 µm. f , Bar graphs showing colocalization quantification performed on organoid sections. Data presented as mean ± s.d.; three individual organoids were analyzed per condition; one-way ANOVA with Tukey’s multiple-comparison post hoc corrections. a.u., arbitrary units.

Source data

We next performed whole-organoid RNA sequencing (RNA-seq) to compare the transcriptomes of senolytic-treated and vehicle control 9-month-old BOs. Consistent with our protein expression data (Fig. 1b,d ), lamin B1 messenger RNA levels were significantly upregulated in all three senolytic-treated organoids compared with vehicle-treated counterparts (Fig. 2a–c ). We further identified 81 senescence-associated messenger RNAs (including proinflammatory genes CXCL13 and TNFAIP8 ) that were consistently suppressed following all three senolytic interventions (Fig. 2d and Extended Data Fig. 2a ). We also noticed, however, that individual senolytic treatments exerted substantially different effects in modulation of SASP and other senescence-associated mRNAs (Fig. 2a–c ). For instance, SERPINF1 mRNA level was significantly repressed following ABT-737 administration (Fig. 2b ) while D + Q did not modulate SERPINF1 gene expression but markedly supressed IL8, SERPINE1 and IL1A mRNA levels (Fig. 2c ). Compared with navitoclax and ABT-737—compounds that modulate the expression of multiple shared genes enriched for a few pathways (for example, K-Ras signaling; Fig. 2e) —D + Q had a more broad-spectrum effect, mitigating multiple proinflammatory pathways characteristic of cellular senescence including NF-κB and IFNγ signaling (Fig. 2e and Extended Data Fig. 2b ). In addition, we identified mTOR as a significantly supressed pathway following D + Q treatment (Fig. 2e ), validating the effects reported for Q as an inhibitor of mTOR kinase. We next performed aging clock predictions based on whole-transcriptome sequencing to further explore the impact of senolytics on the aging process. Remarkably, in addition to their senolytic mechanisms of action, D + Q treatments on 9-month-old organoids reverted their gene expression age to levels comparable to 8-month-old counterparts according to transcriptomic brain aging clock analysis (Fig. 2f ), a phenotype not recapitulated by the other two senolytics tested. Besides negative association with known signatures of aging 29 (Fig. 2g ), gene expression changes induced by D + Q treatment were positively correlated with mammalian signatures of established lifespan-extending interventions 30 , such as caloric restriction (CR) and rapamycin administration (Fig. 2g ), indicating a health-promoting role of D + Q in targeting cellular senescence and biological aging in human CNS tissues.

a – g , BOs were generated and grown in vitro for 8 months and subsequently exposed to two doses (one every 2 weeks) of either navitoclax (2.5 μM), ABT-737 (10 μM) or D + Q (D, 10 μM; Q, 25 μM) within the following month, after which organoids were collected and subjected to bulk RNA-seq analysis. a – c , Volcano plots showing vehicle-treated versus navitoclax- ( a ), ABT-737- ( b ) and D + Q-treated ( c ) BO differential expression of upregulated (blue) and downregulated (red) mRNAs ( P  < 0.05, log 2 FC > 0). d , Venn diagram showing differentially repressed senescence-associated mRNAs among senolytic-treated organoids, defined by significance P  < 0.05 and log 2 FC > 0. e , GSEA was carried out using aging hallmark gene sets from the Molecular Signature Database. Statistically significant signatures were selected ( P  < 0.05, false discovery rate < 0.25) and placed in order of NES. Bars indicate pathways enriched in individual senolytic treatments compared with vehicle-treated BOs. f , Transcriptomic age (tAge) of organoids treated with either vehicle or senolytic compounds assessed using the brain multispecies aging clock. Three individual organoids were analyzed per condition. Box-and-whisker plot (minimum, 25th percentile; median, 75th percentile; maximum). g , Spearman correlation between gene expression changes induced by senolytics in aged organoids and signatures of aging and established lifespan-extending interventions based on functional enrichment output. NES calculated with GSEA were used to evaluate correlations between pairs of signatures.

SARS-CoV-2 infection triggers senescence in brains of patients with COVID-19 and in human BOs

Given the observed neuroinflammatory effects of SARS-CoV-2 infection during acute COVID-19 disease 31 and its association with molecular signatures of aging in patient brains 18 , we postulated that part of this proinflammatory aging-promoting environment is brought about by SARS-CoV-2-induced senescence in the brain. To test this hypothesis we quantified the prevalence of senescent cells in postmortem frontal cortex from age-matched brains of patients that either died following severe COVID-19 or that died from noninfectious and non-neurological causes. Notably, in situ high-throughput analysis of >2.7 million single cells across 15 individual brain samples (seven COVID-19 and eight non-COVID-19 frontal cortex sections) revealed increased p16 immunoreactivity frequencies in the brains of patients with COVID-19, with an increase of over sevenfold in the number of p16-positive cells compared with non-COVID-19 age-matched controls (Fig. 3 and Extended Data Fig. 2c ). These results suggest a potential role for SARS-CoV-2 in triggering cellular senescence, a cellular phenotype that contributes to cognitive decline and that could pose a risk regarding the acceleration of neurodegenerative processes associated with long-COVID.

a , Immunofluorescence images showing DAPI (blue) and p16 (red) immunoreactivity in sections of frontal cortex regions from patients with severe COVID-19 and age-matched non-COVID-related controls. Scale bar, 50 μm. b , Box-and-whisker plots (minimum, 25th percentile; median, 75th percentile; maximum) showing percentage of p16-positive cells. Each data point represents a single patient analyzed, with a total of 2,794,379 individual brain cells across seven patients with COVID-19 and eight non-COVID-19. Two-tailed Student’s t -test.

To study the role of neurotropic viruses in aging-driven neuropathology, we exposed human BOs to different viral pathogens including SARS-CoV-2. Consistent with previous reports 8 , 9 , 12 , 16 , 32 , SARS-CoV-2 BO infections were detected largely within populations of neurons, neural progenitors and microglia (Extended Data Fig. 3a–d ). To test putative virus-induced senescence phenotypes we screened seven SARS-CoV-2 variants by infecting human BOs at identical multiplicity of infection (MOI) and ranked them based on SA-β-gal activity as initial readouts of cellular senescence. Notably, most variants elicited a significant increase in SA-β-gal, with Delta (B.1.617.2) showing the strongest induction (Fig. 4a,b ), and this was accompanied by an overall increase in the number of p16- and p21-positive cells (Extended Data Fig. 3e,f ). In addition, serial sectioning of Delta-infected organoids revealed a distinctive colocalization between SA-β-gal and viral Spike protein (Fig. 4c ), further supporting a role for SARS-CoV-2 in driving virus-induced senescence in the brain. This phenotype was confirmed when organoid sections were coimmunolabeled with antibodies against p16 and SARS-CoV-2 nucleocapsid antigens (Fig. 4d ). Importantly, we observed a statistically greater senescence induction between BOs infected for 5 and 10 days (days post infection, dpi; Extended Data Fig. 3g ). This occurred in the absence of viral replication, which was detectable only in the first 3 days (Extended Data Fig. 3h ). Collectively these observations suggest that the increased senescence observed at 10 versus 5 dpi may have been the result of secondary senescence triggered by the initial SARS-CoV-2 infection and ensuing induced senescence phenotype. Indeed, in Delta-infected BOs, when monitoring peripheral senescence in close vicinity (<150 μm) to virus-infected senescent cells we observed an enrichment of senescent cells negative for SARS-CoV-2 (Extended Data Fig. 3i ), further indicating putative bystander effects of SARS-CoV-2-infected cells in inducing secondary senescence at proximal sites of infection. Because of the mechanistic role of DNA damage in affecting most aging hallmarks 33 , including the onset of cellular senescence 34 , we next explored whether SARS-CoV-2 infection would lead to DNA double-strand break accumulation. Consistent with previous evidence 35 , we detected significantly heightened levels of phosphorylated histone H2AX at serine 139 (known as γH2AX) in SARS-CoV-2-infected organoid regions compared with uninfected organoid cells (Fig. 4e,f ), indicating increased DNA damage response marks following SARS-CoV-2 infection. Importantly, virus-induced senescence also became detectable in response to a variety of human neurotropic viruses, including JEV, Rocio virus (ROCV) and ZIKV in human BOs (Fig. 4g ).

a , SARS-CoV-2 variant screening was performed on BOs and monitored for SA-β-gal activity at 5 dpi. Scale bar, 0.3 mm. b , Quantification of data presented in a . Bar graphs show the percentage of SA-β-gal-positive cells. Each data point in the bar graph represents a single organoid analyzed ( n  = 5–29). Data presented as mean ± s.d.; one-way ANOVA with Dunnett’s multiple-comparison post hoc corrections. c , Representative images of Delta-infected organoid sections stained for SA-β-gal and SARS-CoV-2 Spike protein. d , Representative images of the region shown in c coimmunolabeled for p16 and SARS-CoV-2 nucleocapsid (NC). c , d , One representative experiment out of two is shown. Scale bar, 100 µm. e , Organoids infected for 5 days with SARS-CoV-2 variants were stained for γH2AX and SARS-CoV-2 spike protein. Scale bar, 40 μm. f , Quantification of data presented in e . Scatter plot showing the number of γH2AX foci per cell in infected regions (red) versus uninfected counterparts (black). Each data point in the scatter plot represents a single cell analyzed; at least 400 cells per condition were analyzed; n  = 3 BOs; two-tailed Student’s t -test. g , Human BOs were infected with JEV, ROCV and ZIKV and monitored for SA-β-gal activity at 5 dpi. Box plots show percentage of SA-β-gal-positive cells. Each data point represents a single organoid ( n  = 10–18) analyzed. Box-and-whisker plots (minimum, 25th percentile; median, 75th percentile; maximum); one-way ANOVA with multiple-comparison post hoc corrections. h – k , Uninfected, Wuhan- and Delta-infected human BOs were subjected to ROI selection based on p16 protein expression for spatial profiling by the Nanostring GeoMX digital spatial profiler assay, and further sequenced for the GeoMx Human Whole Transcriptome Atlas. h , Representative p16-positive ROIs. Scale bar, 200 µm. i , Heatmap of polarity showing expression above (blue) and below (red) the mean for each differentially heightened SASP mRNA of Delta-infected, p16-positive ROIs. j , SenMayo and SenSig senescence signature heatmap gene expression of Delta-infected p16-positive cells. k , Floating bars (minimum, mean, maximum) showing expression enrichment of SARS-CoV-2 RNAs (Spike, ORF1ab) for each SARS-CoV-2 variant. Each data point in the box plot represents a normalized FC value of SARS-CoV-2 RNAs of p16-positive ROIs relative to p16-negative counterparts (indicated by grid line). n  = 3–5 p16-positive ROIs were analyzed per condition; two-tailed Student’s t -test. NS, not significant.

Because SARS-CoV-2 infection is coupled with cognitive decline and signatures of aging, we further assessed associations of transcriptomic changes in patients with COVID-19 and SARS-CoV-2-infected human BOs. Specifically, we compared postmortem frontal cortex transcriptomic data from a COVID-19 cohort study of 44 individual patient brains 18 with bulk RNA-seq that we performed on human cortical BOs 10 dpi. Notably, among 1,588 differentially expressed genes (DEGs) between SARS-CoV-2-infected human BOs and uninfected counterparts, 485 genes (30.54%) were also differentially expressed in brain samples from patients with COVID-19. Of note, this common gene set was enriched for known aging and senescence pathways, identified in the hallmark gene set collection of the Molecular Signatures Database 36 (Extended Data Fig. 4a ).

To better understand the differential effects of the ancestral Wuhan virus and Delta (B.1.617.2) SARS-CoV-2 variants on senescence induction in BOs, we next performed NanoString GeoMx spatial transcriptomic sequencing on p16 protein-expressing regions of interest (ROIs) within organoid sections (Fig. 4h ). ROI selection was performed to enable the capture of targeted transcriptome from sufficient senescent cell tissue (>300 cells per ROI) to generate robust count data. Our bulk RNA-seq analysis revealed 1,250 DEGs in Wuhan-infected BOs compared with only 474 DEGs in Delta-infected counterparts (Extended Data Fig. 4b ), a result possibly explained by the higher infectivity rate observed in Wuhan-infected organoids (Extended Data Fig. 4c,d ). Strikingly, spatial transcriptome analysis of p16-positive cells identified >1,100 DEGs in Delta-infected organoids, an effect 100-fold greater than in Wuhan where only nine DEGs were detected (Extended Data Fig. 4b ). This was explained by principal component analysis, where gene set space determined that Delta-infected ROIs were separable from overlapping transcriptomes from Wuhan-infected and uninfected senescent cell regions (Extended Data Fig. 5a ). Following extensive analysis of significantly modulated gene expression in p16-positive ROIs of Delta-infected organoids, we identified 458 genes associated with cellular senescence that differentially clustered from Wuhan-infected and uninfected ROIs (Fig. 4i ), and revealed a distinct enrichment of senescence gene sets SenMayo 37 and SenSig 38 within Delta-infected ROIs (Fig. 4j and Extended Data Fig. 4e ). Importantly, this unique Delta-specific senescence transcriptional signature was detected in the presence of heightened normalized SARS-CoV-2 gene expression in Delta compared to p16-positive cells of Wuhan-infected organoids (Fig. 4k ).

Taken together, these results demonstrate a direct role for SARS-CoV-2 and neurotropic flaviviruses in fueling virus-induced senescence, and reveal a specific effect of Delta (B.1.617.2) in promoting the selective induction of a de novo transcriptional signature and simultaneous accumulation of SARS-CoV-2 in senescent cells of human BOs.

Senolytics reduce SARS-CoV-2 viral expression and virus-induced senescence in human BOs

The results described so far support a functional role of SARS-CoV-2 in inducing brain cellular senescence. To investigate whether this virus-induced phenotype could be pharmacologically targeted, we next tested the impact of the selective removal of senescent cells with the same senolytic interventions that we previously showed as being effective in elimination of senescent cells from physiologically aged organoids (Fig. 5a ). We observed that senolytic treatments 5 days post SARS-CoV-2 infection significantly reduced the number of organoid cells showing SA-β-gal activity (Fig. 5b ). Notably, senolytic treatment of Delta-infected BOs had an overall more prominent and statistically significant effect on reduction of cellular senescence compared with Wuhan-infected counterparts, consistent with the stronger virus-induced senescence phenotype observed following Delta infections in our initial SARS-CoV-2 variant screening (Fig. 4a,b ). Moreover, senolytics were able to revert p21 upregulation and lamin B1 loss induced by Delta infections (Extended Data Fig. 5b ). Remarkably, treatment with senolytics reduced viral load in BOs up to 40-fold as measured by intracellular SARS-CoV-2 RNA levels (Fig. 5c ), indicating a putative role for senescent cells as reservoirs that may preferentially facilitate viral replication. Notably, pretreatment of BOs with senolytics before SARS-CoV-2 infection significantly reduced virus-induced senescence, suggesting that naturally emerging senescent cells contribute to BO viral entry and the subsequent onset and spread of virus-induced senescence (Extended Data Fig. 5c,d ). To characterize the cell type specificity of SARS-CoV-2-induced senescence we performed deconvolution of spatial GeoMx transcriptomic data from p16-positive cells (Fig. 5d ), a type of analysis we use to enable cell abundance estimates from gene expression patterns based on a training matrix of single-cell sequencing data from the Allen Human Brain Atlas 39 . This identified layer 6 corticothalamic neurons (L6CT L6b, over ninefold induction) and GABAergic ganglionic eminence neurons (CGE, over fourfold induction) as the two neuronal populations that showed significantly increased senescence incidence following SARS-CoV-2 infections in BOs (Fig. 5e )—two brain cell populations that are vital in modulation of neural circuitry and processing of incoming sensory information 40 . Importantly, all three senolytic treatments tested prevented the accumulation of cellular senescence in both L6CT L6b and CGE BO cell populations (Fig. 5e ).

a , Schematic representation of experimental design pertaining to b – e . Human BOs were SARS-CoV-2 infected at MOI 1 for 5 days and subsequently exposed to the indicated senolytic treatments for five additional days. Analysis was performed at the end timepoint of the 10-day experiment. b , SA-β-gal activity was evaluated at 10 dpi. Bar graphs showing percentage of SA-β-gal-positive cells. Each data point in the bar graph represents a single organoid ( n  = 7–17) analyzed. Data presented as mean ± s.d.; one-way ANOVA with multiple-comparison post hoc corrections. Scale bar, 0.3 mm. c , Total RNA from individual organoids uninfected or infected with the SARS-CoV-2 Delta variant was used to quantify the indicated levels of viral RNAs, normalized to RPLP0 mRNA and compared with infected vehicle controls. Error bars represent s.e.m.; n  = 3 independent organoids; one-way ANOVA with multiple-comparison post hoc corrections; ND, not detected; RdRP, RNA-dependent RNA polymerase. d , Stacked bars showing NanoString GeoMx deconvolved p16-positive ROI cell abundance using constrained log-normal regression from organoids either uninfected or infected with the SARS-CoV-2 Delta variant. L4/5/6 IT Car3, glutamatergic neurons; L5 ET, cortical layer 5 pyramidal neurons; L6CT L6b, corticothalamic (CT) pyramidal neurons in layer 6; CGE, GABAergic ganglionic eminence neurons; VLMC, vascular and leptomeningeal cells. e , Floating bar graphs (minimum, mean, maximum) showing percentage of deconvolved p16-positive neuronal populations significantly modulated following SARS-CoV-2 Delta variant infection and subsequent senolytic interventions. n  = 3 independent ROIs per condition tested; * P  < 0.05, one-way ANOVA with multiple-comparison post hoc corrections.

Senolytic treatments mitigate COVID-19 brain pathology in vivo

To investigate the consequences of CNS SARS-CoV-2 infection and ensuing brain virus-induced senescence in a more physiologically complete system, we utilized transgenic mice expressing the human ACE2 gene under the control of the keratin 18 promoter (K18-hACE2) 41 and performed intranasal SARS-CoV-2 infections using the Delta variant, because it demonstrated the most significant virus-induced senescence in our human BO experiments. Notably, we found brain viral nucleocapsid antigen in cerebral cortex and brainstem regions (Extended Data Fig. 6a ). Experimentally, 24 h post infection we initiated oral administration of the senolytic interventions navitoclax, fisetin and D + Q—drugs known to exert blood–brain barrier permeability 22 , 42 —with subsequent treatments every 2 days (Fig. 6a ). As previously reported, SARS-CoV-2-infected K18-hACE2 transgenic mice underwent dramatically shortened lifespans following infection 41 , with a median survival of 5 days. Strikingly, treatment with D + Q or fisetin significantly improved the survival of K18-hACE2 mice compared with vehicle-treated controls, with extended median lifespans of 60% (Fig. 6b ). Furthermore, while at 10 dpi all vehicle-treated control mice were already dead, at survival experimental endpoint (12 dpi) a percentage of senolytic-treated mice—22% (fisetin), 38% (D + Q) and 13% (navitoclax)—remained alive (Fig. 6b ). This significantly improved survival following senolytic administration of infected mice concurrently delayed the rapid weight loss observed in the infected control group (Extended Data Fig. 6b ). Throughout the first week of in vivo experiments, mice were clinically monitored and scored daily for behavioral and physical performance (Fig. 6c ). Notably, senolytic interventions resulted in a profound reduction in COVID-related disease features, especially in the D + Q-treated group (Fig. 6c ).

a , Schematic representation of experimental design pertaining to b – h . K18-hACE2 transgenic mice were exposed to Delta variant infection on day 0 and subsequently treated with senolytics every other day starting on day 1. Mice were euthanized on day 5 for brain tissue characterization, as well as for end timepoint experiments to monitor clinical score and survival. b , Kaplan–Meier curve of uninfected mice ( n  = 3) and of infected mice treated with vehicle ( n  = 6), fisetin ( n  = 9), D + Q ( n  = 8) or navitoclax ( n  = 8). * P  = 0.032 for vehicle versus fisetin curve comparison; ** P  = 0.0087 for vehicle versus D + Q curve comparison; log-rank (Mantel–Cox) test. c , Average combined behavioral and physical clinical score, over time, of uninfected mice ( n  = 3) and of SARS-CoV-2-infected mice treated with vehicle ( n  = 6), fisetin ( n  = 8), D + Q ( n  = 8) or navitoclax ( n  = 8). Error bars represent s.e.m.; color-coded * P  < 0.05 for comparisons between vehicle and each color-coded senolytic treatment; one-way ANOVA with multiple-comparison post hoc corrections for every timepoint tested. d , Total RNA of individual brains from mice—either uninfected or Delta variant-infected and treated with senolytics—was used to quantify the indicated levels of viral RNAs and was normalized to Rplp0 mRNA and compared with infected vehicle controls. Error bars represent s.e.m.; n  = 8 mouse brains per condition; one-way ANOVA with multiple-comparison post hoc corrections. e , Total RNA of individual brains from mice— either uninfected or infected with SARS-CoV-2 Delta variant and treated with various senolytic interventions—was used to quantify mRNA expression levels of the indicated senescence and SASP RNAs and was normalized to Rplp0 mRNA. Each column in the heatmap represents an individual mouse brain analyzed. f , Representative immunofluorescent images of brainstem sections from mice either uninfected or infected with the SARS-CoV-2 Delta variant and treated with the indicated senolytics. Samples were immunolabeled with antibodies against TH (red; scale bar, 100 µm) and GFAP (green; scale bar, 50 µm). g , Quantification of TH data presented in f . Bar graph showing the intensity of TH staining. Each data point in the bar graph represents average TH intensity analyzed per mouse brain ( n  = 3). Data presented as mean ± s.d.; **** P  < 0.0001, one-way ANOVA with multiple-comparison post hoc corrections. h , Quantification of GFAP data presented in f . Dot plot shows the intensity of GFAP per cell. Each data point in the dot blot represents a single cell analyzed. **** P  < 0.0001; three brains per condition were analyzed; one-way ANOVA with multiple-comparison post hoc corrections.

Given the positive survival and improved clinical performance outcomes induced by senolytic treatment, a phenomenon partially explained by reduction in lung senescence (Extended Data Fig. 6c ) and pathology as previously shown 19 , 43 , we investigated whether the oral administration of senolytics would impact the histological architecture and proinflammatory makeup of brains from infected mice. To this end we first tested the impact of senolytics on brain viral RNA levels. In accordance with our brain organoid data (Fig. 5c ), senolytic treatments of infected K18-hACE2 mice significantly lowered viral gene expression compared with infected vehicle-treated mice (Fig. 6d ), further supporting a putative role for senescent cells in preferential sustenance of SARS-CoV-2 replication. We next tested whether senescent cell clearance would directly impact the transcription of SASP and senescence genes in the brain. mRNA expression analyses from brains of uninfected and infected mice indicated an overall increase in inflammatory SASP and p16 senescence markers in the brains of infected mice (Fig. 6e ). Most importantly, all three senolytic interventions consistently normalized brain SASP and senescence gene expression of infected mice to levels comparable to those of uninfected brains (Fig. 6e ).

Neuroinvasive viral infections can result in loss of dopaminergic neurons and ensuing PAIS such as parkinsonism 44 . Given the long-term neurological impact of COVID-19, including coordination and consciousness disorders 45 , we therefore tested the impact of SARS-CoV-2 infection on alteration of dopaminergic neuron survival within the brainstem, an important region of the brain known to regulate these behaviors. Strikingly, Delta variant infection induced a marked loss of dopaminergic neurons in the brainstem as measured by tyrosine hydroxylase (TH) immunolabeling (Fig. 6f,g ), and this was accompanied by increased astrogliosis (Fig. 6f,h ), a neurotoxic process common to multiple neurological disorders 46 . Importantly, recurrent senolytic treatments initiated 24 h following SARS-CoV-2 exposure partially prevented dopaminergic neuron loss and abrogated the onset of reactive astrogliosis (Fig. 6f–h ).

Brain aging and related cognitive deficiency have been attributed to diverse molecular processes, including chronic inflammation and cellular senescence 47 . This has been studied in both normal murine aging 24 and different age-related mouse models of neurodegeneration such as Parkinson’s disease 48 , tauopathies 23 , 49 , amyloid-beta neuropathology 22 and neuropsychiatric disorders 50 . However, whether the endogenous age-related onset of cellular senescence impacts brain aging in human tissue systems has not been investigated. Neither have the putative consequences of neurotropic viral infections in accelerating the onset of cellular senescence in the brain been examined.

Our findings herein show that: (1) senescent cells accumulate in physiologically aged BOs of human origin and that long-term (4 weeks), intermittent senolytic treatment reduces inflammation and cellular senescence; (2) interventions unique to D + Q treatments induce antiaging and prolongevity gene expression changes in human BOs; (3) brains from COVID-19 patients undergo accelerated cellular senescence accumulation compared to age-matched controls; (4) SARS-CoV-2 and neurotropic viruses, including ZIKV and JEV, can infect human BOs to directly induce cellular senescence; (5) Delta (B.1.617.2) variant induces the strongest SARS-CoV-2-dependent induction of cellular senescence, where spatial transcriptomic sequencing of p16-positive cells identified a Delta-specific SASP signature; (6) short-term (5 days) senolytic treatments of SARS-CoV-2-infected organoids reduce viral gene expression and prevent the onset of senescent neurons of corticothalamic and GABAergic nature; and (7) senolytic treatment following SARS-CoV-2 intranasal infection of K18-hACE2 mice ameliorates COVID-19 neuropathology, including improvements in clinical score and survival, alleviation of reactive astrogliosis, increased survival of dopaminergic neurons and reduced viral, SASP and senescence gene expression in the brain of infected mice.

To evaluate the relationship between senescent cell accumulation and brain aging, we designed studies to eliminate senescent cells through pharmacologic approaches (D + Q, navitoclax and ABT-737) and hypothesized that senolytic interventions may have beneficial consequences in targeting brain aging. We found that physiologically aged human BOs accumulate senescent cells, mostly within astrocyte and mature neuron populations, and that senolytic treatment can be used as a proof-of-concept strategy to revert lamin B1 levels and alleviate differential SASP expression and senescent cell burden in human brain BO systems. In addition to senolytic activity, transcriptomic aging clocks identified D + Q as an intervention that achieved tissue rejuvenation, because 8-month-old human BOs displayed aging clocks comparable to those of D + Q-treated 9-month-old counterparts. Given that senescent cell clearance results in reversal of the aging process, these findings support an important role for senescent cells in driving human brain aging.

Further to normal brain aging, we tested the possibility of virus-induced senescence following BO neurotropic infections. We found that flaviviral JEV, ROCV and ZIKV infections—and multiple SARS-CoV-2 variant infections—led to a significant increase in BO cellular senescence. Importantly, following senolytic delivery, BOs showed a marked loss of SARS-CoV-2 viral RNA expression, suggestive of a role for senescent cells in preferential facilitation of viral entry and retention, consistent with data showing increased ACE2 expression in human senescent cells 51 . Furthermore, SARS-CoV-2 induces metabolic changes in infected and neighboring neurons 8 , a paracrine phenomenon reminiscent of the bystander effect characteristic of senescent cells 52 . Here, spatial transcriptomic sequencing cell deconvolution of p16 protein-expressing cell clusters identified two neuronal populations—corticothalamic and GABAergic—that become senescent and broadly develop a de novo SASP signature following Delta (B.1.617.2) infection. It will therefore be of interest to determine whether neuronal virus-induced senescence contributes to neuroinflammation and the long-term neurological impact of COVID-19.

In the brains of SARS-CoV-2-infected K18-hACE2 mice we found that senolytic treatment alleviates p16 and the levels of proinflammatory cytokines that may be due, in part, to removal of virus-induced senescence and ensuing SASP expression. However, secondary anti-inflammatory and/or antiviral effects of D + Q, fisetin or navitoclax—for instance, by direct inhibition of the observed astrogliosis—are also possible. Likewise, the crossing by navitoclax through the blood–brain barrier, particularly in young mice, is a matter of contention. As a result, the decline in senescence observed in the brains of infected mice may be an indirect consequence of senescent cell clearance in other organs, including the lungs. Following systematic monitoring of clinical performance in SARS-CoV-2-infected mice, we found that intermittent senolytic treatment significantly improved animal behavior and survival. This beneficial clinical effect of senolytics was associated with reduced brain inflammation and increased survival of dopaminergic neurons. Indeed, inflammatory cytokines as part of the SASP can impair brain plasticity 53 , suggesting that the beneficial effects of senolytic treatment on the COVID-19 neurological clinical picture may result from suppression of senescence-dependent inflammation and improved neuronal survival. This is consistent with preclinical studies demonstrating a beneficial effect of senescent cell clearance in reducing inflammatory/SASP gene expression in the brains of geriatric mice infected with a SARS-CoV-2-related mouse β-coronavirus 54 . Whether our in vivo effects of senolytics on COVID-19 neuropathology resulted solely from clearance of cellular senescence or also involved actions on dopaminergic neurons and other brain regions remains to be determined. Likewise, given the nature of the in vivo treatments, it is conceivable that the observed results on brain pathology are a consequence of a systemic impact caused by improved lung function. It is, however, crucial to emphasize the important contribution of our human BO experiments because they eliminate the potential confounding effects present in infections affecting multiple organs in our in vivo experiments. Indeed, the data from BOs provide compelling evidence of a distinct senescence phenotype resulting from direct infection by SARS-CoV-2, as well as from other neurotropic viruses such as ZIKV. Moreover, targeted treatment of infected organoids with senolytics shows a significant alleviation of virus-induced senescence and the associated secretome, indicating the direct efficacy of our interventions in cell types of the central nervous system. This pharmacological outcome remains independent of any potential secondary senescence that could have originated from other infected organs in a model conducted in vivo. In this study we have provided important evidence that paves the way for future clinical studies that will test the hypothesis that senolytic therapies can suppress long-COVID neuropathology and other long-term disorders caused by acute neurotropic viral infections.

Ethics and biological safety

All animal experiments were performed according to guidelines promoting the wellbeing of animals used for scientific research from The University of Queensland (UQ), and according to the Australian code for the care and use of animals for scientific purposes. The use of animals was approved by the UQ Animal Ethics Committee under project no. 2021/AE001119. Mice were housed within the BSL-3 facility using the IsoCage N-Biocontainment System (Tecniplast), where each cage was supplied with a high-efficiency, particulate-absorbing filter preventing viral contamination between cages. This IsoCage system also provides individual ventilation to the cages, maintaining humidity at <65–70% and temperature 20–23 °C. Mice were kept under a 12/12 h light/dark cycle with food and water provided ad libitum.

Pathogenic SARS-CoV-2 variants and encephalitic flaviviruses were handled under certified biosafety level-3 (BSL-3) conditions at the School of Chemistry and Molecular Biosciences (SCMB), Australian Institute for Bioengineering and Nanotechnology and Institute for Molecular Bioscience at UQ. All approved researchers used disposable Tychem 2000 coveralls (Dupont, no. TC198T YL) at all times and also used either powered air-purifying respirators (PAPR, SR500 Fan Unit) or Versaflo‐powered air‐purifying respirators (3M, no. 902‐03‐99) as respiratory protection. All pathogenic materials were handled in a class II biosafety cabinet within the BSL-3 facility. For downstream analysis, all samples containing infectious viruses were appropriately inactivated in accordance with the BSL-3 manual. Liquid and solid waste were steam sterilized by autoclave. This study was approved by the Institutional Biosafety Committee from UQ under approval nos. IBC/485B/SCMB/2021 and IBC/447B/SCMB/2021. Differentiation of hPSCs into organoids and their subsequent use was approved by the UQ Institutional Research Ethics Committee under approval no. 2019000159. The WA09 PSC cell line was obtained before this study following receipt of informed consent and approval by the NIH hESC Registry (no. NIHhESC-10-0062). Analysis of human brain sections was performed with the approval of the Ethics Committee of the University of Freiburg (no. 10008/09). Consent for autopsy was provided by the individuals’ next of kin or healthcare proxy according to German law (participant compensation was not applicable). The study was performed in agreement with the principles expressed in the Declaration of Helsinki, 2013.

Generation and culture of PSC-derived human BOs

Organoid generation was carried out as previously described 55 , with some modifications. Human WA09 hPSCs were obtained, contamination free, from WiCell, with verified normal karyotype and were routinely tested and confirmed negative for mycoplasma (MycoAlert, Lonza). hPSCs were maintained in mTeSR medium (STEMCELL Technologies, no. 85850) on matrigel-coated plates (Corning, no. 354234). On day 0 of organoid differentiation, PSCs were dissociated with Accutase (Life Technologies, no. 00-4555-56) and seeded at a density of 15,000 cells per well on a 96-well, low-attachment U-bottom plate (Sigma, no. CLS7007) in mTeSR plus 10 μM ROCK inhibitor (VWR, no. 688000-5). The 96-well plate was then spun at 330 g for 5 min to aggregate the cells and create spheroids. The spheroids were fed every day for 5 days in medium containing DMEM/F12 (Invitrogen, no. 11330-032), knockout serum (Invitrogen, no. 11320-033), 1:100 GlutaMax, 1:200 MEM-NEAA supplemented with dual SMAD inhibitors, 2 μM dorsomorphin (StemMACS, no. 130-104-466) and 2 μM A-83-01 (Lonza, no. 9094360). On day 6, half of the medium was changed to induction medium containing DMEM/F12, 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement (Invitrogen, no. 17502048) and 1 μg ml –1 heparin (Sigma, no. H3149) supplemented with 1 μM CHIR 99021 (Lonza, no. 2520691) and 1 μM SB-431542 (Sigma, no. S4317). From day 7, complete medium change was carried out with induction medium followed by daily medium change in induction medium for the next 4 days. On day 11 of the protocol, spheroids were transferred to 10 μl droplets of Matrigel on a sheet of Parafilm with 2 mm dimples. These droplets were allowed to gel at 37 °C for 25 min and were subsequently removed from the Parafilm and transferred to, and maintained in, low-attachment 24-well plates (Sigma, no. CLS3473) containing induction medium for the following 5 days. From day 16 the medium was then changed to organoid medium containing a 1:1 mixture of neurobasal medium (Invitrogen, no. 21103049) and DMEM/F12 medium supplemented with 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement, 1:50 B27 supplement (Invitrogen, no. 12587010), 1% penicillin/streptomycin (Sigma, no. P0781), 50 μM 2-mercaptoethanol and 0.25% insulin solution (Sigma, no. I9278). Medium was changed every other day with organoid medium. BOs were maintained in organoid medium until the end of experiments, as indicated. Microglia-containing organoid generation was carried out as previously described 56 and these BOs were matured for 3 months before SARS-CoV-2 exposure at MOI = 1.

Human tissue preparation

Frontal cortex tissue from patients that had tested positive for SARS-CoV-2 and died from severe COVID-19 was obtained at the University Medical Center Freiburg, Germany. Tissue was formalin fixed and embedded in paraffin using a Tissue Processing Center (Leica, no. ASP300). Sections (3 µm thick) were cut and mounted on Superfrost objective slides (Langenbrinck).

RNA Vero E6 cells (African green monkey kidney cell clones) and TMPRSS2-expressing Vero E6 cell lines were maintained in DMEM (Gibco) at 37 °C with 5% CO 2 . In addition, as previously described, the TMPRSS2-expressing Vero E6 cell line was supplemented with 30 μg ml –1 puromycin 57 . C6/36 cells, derived from the salivary gland of the mosquito A. albopictus , were grown at 28 °C in RPMI medium (Gibco). All cell line media were supplemented with 10% heat-inactivated fetal calf serum (Bovogen), penicillin (100 U ml –1 ) and streptomycin (100 μg ml –1 . C6/36 medium was also supplemented with 1% GlutaMax (200 mM, Gibco) and 20 mM HEPES (Gibco). All cell lines used in this study were tested for mycoplasma by first culturing cells for 3–5 days in antibiotic-free medium and then subjecting them to mycoplasma testing using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).

Viral isolates

Seven SARS-CoV-2 variants were used in this study: (1) ancestral or Wuhan strain: an early Australian isolate, hCoV-19/Australia/QLD02/2020, sampled on 30 January 2020 (Global Initiative on Sharing All Influenza Data (GISAID) Accession ID: EPI_ISL_407896); (2) Alpha (B.1.1.7), named hCoV-19/Australia/QLD1517/2021 and collected on 6 January 2021 (GISAID accession ID: EPI_ISL_944644); (3) Beta (B.1.351), hCoV-19/Australia/QLD1520/2020, collected on 29 December 2020 (GISAID accession ID: EPI_ISL_968081); (4) Delta (B.1.617), hCoV-19/Australia/QLD1893C/2021 collected on 5 April 2021 (GISAID accession ID: EPI_ISL_2433928); (5) Gamma (P.1), hCoV-19/Australia/NSW4318/2021 sampled on 1 March 2021 (GISAID accession ID: EPI_ISL_1121976); (6) Lambda (C.37), hCoV-19/Australia/NSW4431/2021 collected on 3 April 2021 (GISAID accession ID: EPI_ISL_1494722); and (7) Omicron (BA.1), hCoV-19/Australia/NSW-RPAH-1933/2021 collected on 27 November 2021 (GISAID accession ID: EPI_ISL_6814922). All viral isolates obtained were passaged twice, except for Gamma and Lambda variants, which were passaged three times. Viral stocks were generated on TMPRSS2-expressing Vero E6 cells to ensure no Spike furin cleavage site loss. To authenticate SARS-CoV-2 isolates used in the study, viral RNA was extracted from stocks using TRIzol LS reagent (Thermo Fisher Scientific) and complementary DNA was prepared with a Protoscript II first-strand cDNA synthesis kit according to the manufacturer’s protocol (New England Biolabs). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers: CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG, CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC, under conditions previously described 57 . For encephalitic flaviviruses, virulent strains of ZIKV (Natal (GenBank: KU527068.1 )), JEV (Nakayama strain (GenBank: EF571853.1 )) and ROCV (GenBank: AY632542.4 ) were propagated on C6/36 to generate viral stock for all experiments. Viral titers were determined by immunoplaque assay 58 .

RNA isolation

RNA from BOs and mouse tissue was extracted with the RNeasy Mini Kit (Qiagen) for mRNA detection, according to the manufacturer’s instructions. Mouse tissue was homogenized with a TissueLyser II (Qiagen) at 30 Hz for 60 s. RNA integrity of BOs and mouse tissue was evaluated by analysis on a 2100 Bioanalyzer RNA 6000 Pico Chip kit (Agilent) using RNA integrity number. RNA samples with RNA integrity number >7 were considered to be of sufficiently high quality for real-time quantitative PCR, and for transcriptomic library construction and RNA-seq, according to the manufacturer’s instructions.

Real-time quantitative PCR

Total RNA (1 μg) was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-Rad). A volume corresponding to 5 ng of initial RNA was utilized for each real-time PCR reaction using PowerUp SYBR Green Master Mix (Applied Biosystems) on a CFX Opus Real-Time PCR detection system (data collection was performed via Bio-Rad’s CFX Maestro Software, v.2.3). Ribosomal protein P0 (RPLP0) was used as control transcript for normalization. Primer sequences (5'–3' orientation) are listed in Supplementary Table 1 .

Brain organoids on low-adhesion plates were infected overnight (14 h) with the indicated flaviviruses and SARS-CoV-2 variants at MOI = 0.1 and 1.0, respectively; BOs were then washed three times with lipopolysaccharide-free PBS, with the addition of maintenance medium, and maintained for 5 dpi.

Senolytic treatments in vitro

For infection experiments, 5 days following viral exposure, BOs were treated with a single dose of either navitoclax (2.5 μM), ABT-737 (10 μM) or D + Q (D, 10 μM; Q, 25 μM) and monitored for 5 days following treatment. In regard to senolytic interventions on physiologically aged 8-month-old organoids, BOs were treated with a weekly dose of either navitoclax (2.5 μM), ABT-737 (10 μM) or D + Q (D, 10 μM; Q, 25 μM) for 4 weeks and subsequently collected for downstream analysis.

SARS-CoV-2-driven COVID-19 animal experiments

In vivo experiments were performed using 6-week-old K18-hACE2 transgenic female mice obtained from the Animal Resources Centre (Australia). For animal infections, SARS-CoV-2 was delivered intranasally—20 μl of the Delta variant at 5 × 10 3 focus-forming units per mouse—on anesthetized mice (100 mg kg –1 ketamine and 10 mg kg –1 xylazine). Control animals were mock infected with the same volume of RPMI additive-free medium. One day following infection, K18-hACE2 mice were distributed among three treatment groups ( n  = 16 each) and one solvent-only control group ( n  = 16). From 1 dpi, animals were treated by oral gavage with either navitoclax (100 mg kg –1 ), D + Q (D, 5 mg kg –1 ; Q, 50 mg kg –1 ) or fisetin (100 mg kg –1 ) dissolved in 5% DMSO and 95% corn oil every other day. For tissue characterization ( n  = 8 for each infected group), at 6 dpi animals were euthanized and brain specimens collected for RNA expression analysis and histopathological assessment. For clinical and survival evaluation, mice were monitored daily for up to 12 dpi. Clinical scoring included the following: no detectable disease (0); hindlimb weakness, away from littermates or ruffled fur (0.5–1.0); partial hindlimb paralysis, limping, hunched or reluctance to move (1.5–2.0); and complete paralysis of hindlimb, severely restricted mobility, severe distress or death (2.5–3.0).

Organoid sectioning and histology

Brain organoids were fixed in 4% paraformaldehyde for 1 at room temperature (RT) and washed with PBS three times for 10 min each at RT before being allowed to sink in 30% sucrose at 4 °C overnight, and were then embedded in optimal cutting temperature (OCT; Agar Scientific, no. AGR1180) and cryosectioned at 14 μm with a Thermo Scientific NX70 Cryostat. Tissue sections were used for both immunofluorescence and SA-β-gal assay. For immunofluorescence, sections were blocked and permeabilized in 0.1% Triton X-100 and 3% bovine serum albumin in PBS. Sections were incubated with primary antibodies overnight at 4 °C, washed and incubated with secondary antibodies for 40 min at RT. DAPI (0.5 μg ml –1 ; Sigma, no. D9564) was added to secondary antibodies to mark nuclei. Secondary antibodies labeled with Alexafluor 488, 568 or 647 (Invitrogen) were used for detection. SA-β-gal activity at pH 6.0 as a senescence marker in fresh or cryopreserved human samples was assessed as previously described 59 .

Nanostring spatial transcriptomics

OCT-embedded organoids were freshly sectioned and prepared according to the GeoMX Human Whole Transcriptome Atlas Assay slide preparation for RNA profiling (NanoString). Three organoids were used per condition for ROI selection. Fastq files were uploaded to the GeoMX DSP system, where raw and Q3-normalized counts of all targets were aligned with ROIs. The 0.75 quantile-scaled data were used as input. The DESeq2 v.1.30.1 R package 60 was used to identify differently expressed genes in ROI cell subsets. DESeq2 was performed among pairwise comparisons of interest and genes were corrected using Benjamini–Hochberg correction, with only genes with corrected P  < 0.05 retained. Cell abundance was estimated using the SpatialDecon v.1.10.0 R library, which performs mixture deconvolution using constrained log-normal regression and infers cell distributions based on pre-existing single-cell sequencing cell type annotations. Gene expression patterns of GeoMx data were deconvolved based on a training matrix of single-cell sequencing data from the Allen Human Brain Atlas. Projected proportions of different cell types were inferred, and are explained by the overall expression patterns and cell number of each of the spatial trancriptomic regions of interest.

Whole-organoid RNA-seq

Before mRNA sequencing, ribosomal RNA from BO RNA was depleted using the Ribo-Zero rRNA Removal Kit (Illumina). Transcripts were sequenced at Novogene using TruSeq stranded total RNA library preparation and the Illumina NovaSeq 150-base pair, paired-end lane. FastQC was used to check the quality of raw sequences before analysis to confirm data integrity. Trimmed reads were mapped to human genome assembly hg38 using Hisat2 v.2.0.5. To ensure high quality of the count table, the raw count table generated by featureCounts v.1.5.0-p3 was filtered for subsequent analysis. Differential gene expression analysis was performed using Bioconductor DESeq2 R packages. The resulting P  values were adjusted using the Benjamini–Hochberg approach for control of false discovery rate. Genes with adjusted P  < 0.05 found by DESeq2 were assigned as differentially expressed.

Association with gene expression signatures of aging and longevity

To assess the effect of senolytics on the transcriptomic age of BO samples, we applied a brain multispecies (mouse, rat, human) transcriptomic clock based on signatures of aging identified in ref. 30 . Missing values were omitted with the precalculated average values from the clock. Association of gene expression log-fold change (FC) induced by senolytics in aged BO with previously established transcriptomic signatures of aging and established lifespan-extending interventions was examined, as described in ref. 30 . Signatures of aging utilized included multispecies brain signature as well as multitissue aging signatures of mouse, rat and human. Signatures of lifespan-extending interventions included genes differentially expressed in mouse tissues in response to individual interventions including CR, rapamycin (Rapamycin) and mutations associated with growth hormone deficiency (GH deficiency), along with common patterns of lifespan-extending interventions (Common) and endothelial cells (ECs) associated with the intervention effect on mouse maximum (Max lifespan) and median lifespan (Median lifespan).

For identification of enriched functions affected by senolytics in aged BO, we performed functional gene set enrichment analysis (GSEA) 61 on a preranked list of genes based on log 10 ( P ) corrected by the sign of regulation, calculated as

where Pv and l FC are P and logFC, respectively, of a particular gene obtained from edgeR output, and sgn is the signum function (equal to 1, –1 or 0 if the value is positive, negative or equal to 0, respectively). HALLMARK ontology from the Molecular Signature Database was used as gene sets for GSEA. The GSEA algorithm was performed separately for each senolytic via the fgsea package in R, with 5,000 permutations. A q  value cutoff of 0.1 was used for selection of statistically significant functions.

Similar analysis was performed for gene expression signatures of aging and lifespan-extending interventions. Pairwise Spearman correlation was calculated for individual signatures of senolytics, aging and lifespan-extending interventions based on estimated normalized enrichment score (NES) (Fig. 2g ). A heatmap colored by NES was built for manually chosen statistically significant functions (adjusted P  < 0.1) (Extended Data Fig. 1a ). A complete list of functions enriched by genes perturbed by senolytics is included in Source data .

Imaging and analysis

Immunofluorescence images were acquired using either a Zeiss LSM 900 Fast Airyscan 2 super-resolution microscope or a Zeiss AxioScan Z1 Fluorescent Imager. For organoid staining, the number of positive cells per organoid for senescence, cell type and viral markers tested was analyzed using the imaging software CellProfiler (v.4.2.1) and Fiji (v.2.1.0/1.53c), with the same pipeline for each sample in the same experiment. Custom Matlab R2018b (9.5.0.944444) scripts were developed to streamline high-throughput imaging data. The CellProfiler pipeline for the quantification of SA-β-gal-positive cells is available in Supplementary Code 1 .

The following were used: anti-p16 (Cell Signalling, 1:400, no. 80772); anti-p21 (R&D Systems, 1:400, no. AF1047); anti-NeuN (Millipore, 1:1,000, no. ABN78); anti-GFAP (Agilent, 1:2,000, no. Z0334); anti-GFAP (Invitrogen, 1:1,000, no. 13-0300); anti-Sox2 (Cell Signalling, 1:1,000, no. 23064); anti-Sox2 (Cell Signalling, 1:1,000, no. 4900); anti-Sox10 (abcam, 1:500, no. ab229331); anti-Iba1 (Wako, 1:1,000, no. 019-19741); anti-SARS-CoV-2 Nucleocapsid C2, 1:1,000 (ref. 62 ); anti-SARS-CoV-2 Spike protein, 1:1,000 (ref. 63 ); anti-γH2AX (Millipore, 1:1,000, no. 05-636); anti-TH (Invitrogen, 1:1,000, no. PA5-85167); anti-lamin B1 (abcam, 1:5,000, no. ab16048); anti-chicken IgG (Jackson ImmunoResearch, 1:500, no. 703-545-155); anti-rabbit IgG (Invitrogen, 1:400, no. A10042); anti-rabbit IgG (Invitrogen, 1:400, no. A21245); anti-mouse IgG (Invitrogen, 1:400, no. A11029); anti-mouse IgG (Invitrogen, 1:400, no. A21235); and anti-human IgG (Invitrogen, 1:400, no. A21445).

Statistics and reproducibility

All experiments were performed at least two times, except for RNA-seq, mouse experiments and human postmortem analysis. For in vivo experiments, 8–16 mice were analyzed per condition. All bar graph results are shown as mean ± s.e.m. or s.d. as indicated. No statistical methods were used to predetermine sample size, but our sample sizes are similar to those reported in previous publications 19 , 43 . Data distribution was assumed to be normal, but this was not formally tested. No data were excluded from analyses. Data collection and analysis were not performed blind to the conditions of the experiments, with the exception of mouse treatment experiments where the study investigators (E.A.A. and A.A.A.) were blinded to treatment groups by the use of color-coded drug vials generated by an independent investigator (J.A.). No randomization method was used to allocate animals or BOs to experimental groups. P  values were calculated by the indicated statistical tests using either R (v.3.6.0), Microsoft Excel (v.16.77) or GraphPad Prism (v.9.4.0) software. In figure legends n indicates the number of independent experiments or biological replicates.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

RNA-seq raw data have been deposited in the European Nucleotide Archive with primary accession code PRJEB58180 . RNA-seq files accessed from Mavrikaki et al. 18 are available through Gene Expression Omnibus (accession no. GSE188847 ). The sequences of encephalitic flaviviruses used in this study are available in GenBank under accession nos. KU527068.1 (ZIKV), EF571853.1 (JEV) and AY632542 .4 (ROCV). For the SARS-CoV-2 variants used in this study, sequences are available in GISAID under accession nos. EPI_ISL_407896 (Wuhan strain), EPI_ISL_944644 (Alpha, B.1.1.7), EPI_ISL_968081 (Beta, B.1.351), EPI_ISL_2433928 (Delta, B.1.617), EPI_ISL_1121976 (Gamma, P.1), EPI_ISL_1494722 (Lambda, C.37) and EPI_ISL_6814922 (Omicron, BA.1). Source data are provided with this paper.

Code availability

Code used for SA-β-gal image quantifications is available in the Supplementary material. Additional custom code used for processing of imaging data is available from the corresponding author on reasonable request.

Nalbandian, A. et al. Post-acute COVID-19 syndrome. Nat. Med. 27 , 601–615 (2021).

CAS   PubMed Central   PubMed   Google Scholar  

Choutka, J., Jansari, V., Hornig, M. & Iwasaki, A. Unexplained post-acute infection syndromes. Nat. Med. 28 , 911–923 (2022).

CAS   PubMed   Google Scholar  

Taquet, M., Geddes, J. R., Husain, M., Luciano, S. & Harrison, P. J. 6-Month neurological and psychiatric outcomes in 236 379 survivors of COVID-19: a retrospective cohort study using electronic health records. Lancet Psychiatry 8 , 416–427 (2021).

PubMed Central   PubMed   Google Scholar  

Monje, M. & Iwasaki, A. The neurobiology of long COVID. Neuron 110 , 3484–3496 (2022).

Ceban, F. et al. Fatigue and cognitive impairment in post-COVID-19 syndrome: a systematic review and meta-analysis. Brain Behav. Immun. 101 , 93–135 (2022).

Hartung, T. J. et al. Fatigue and cognitive impairment after COVID-19: a prospective multicentre study. EClinicalMedicine 53 , 101651 (2022).

Davis, H. E., McCorkell, L., Vogel, J. M. & Topol, E. J. Long COVID: major findings, mechanisms and recommendations. Nat. Rev. Microbiol. 21 , 133–146 (2023).

Song, E. et al. Neuroinvasion of SARS-CoV-2 in human and mouse brain. J. Exp. Med . 218 , e20202135 (2021).

Zhang, B. Z. et al. SARS-CoV-2 infects human neural progenitor cells and brain organoids. Cell Res. 30 , 928–931 (2020).

Meinhardt, J. et al. Olfactory transmucosal SARS-CoV-2 invasion as a port of central nervous system entry in individuals with COVID-19. Nat. Neurosci. 24 , 168–175 (2021).

Pellegrini, L. et al. SARS-CoV-2 infects the brain choroid plexus and disrupts the blood-CSF barrier in human brain organoids. Cell Stem Cell 27 , 951–961 (2020).

Samudyata et al. SARS-CoV-2 promotes microglial synapse elimination in human brain organoids. Mol. Psychiatry 27 , 3939–3950 (2022).

Albornoz, E. A. et al. SARS-CoV-2 drives NLRP3 inflammasome activation in human microglia through spike protein. Mol. Psychiatry 27 , 3939–3950 (2022).

Google Scholar  

Schwabenland, M. et al. Deep spatial profiling of human COVID-19 brains reveals neuroinflammation with distinct microanatomical microglia-T-cell interactions. Immunity 54 , 1594–1610 (2021).

Cantuti-Castelvetri, L. et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 370 , 856–860 (2020).

Stein, S. R. et al. SARS-CoV-2 infection and persistence in the human body and brain at autopsy. Nature 612 , 758–763 (2022).

Douaud, G. et al. SARS-CoV-2 is associated with changes in brain structure in UK Biobank. Nature 604 , 697–707 (2022).

Mavrikaki, M., Lee, J. D., Solomon, I. H. & Slack, F. J. Severe COVID-19 is associated with molecular signatures of aging in the human brain. Nat. Aging 2 , 1130–1137 (2022).

PubMed   Google Scholar  

Lee, S. et al. Virus-induced senescence is a driver and therapeutic target in COVID-19. Nature 599 , 283–289 (2021).

Lopez-Otin, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G. Hallmarks of aging: an expanding universe. Cell 186 , 243–278 (2023).

Di Micco, R., Krizhanovsky, V., Baker, D. & d’Adda di Fagagna, F. Cellular senescence in ageing: from mechanisms to therapeutic opportunities. Nat. Rev. Mol. Cell Biol. 22 , 75–95 (2021).

Zhang, P. et al. Senolytic therapy alleviates Abeta-associated oligodendrocyte progenitor cell senescence and cognitive deficits in an Alzheimer’s disease model. Nat. Neurosci. 22 , 719–728 (2019).

Bussian, T. J. et al. Clearance of senescent glial cells prevents tau-dependent pathology and cognitive decline. Nature 562 , 578–582 (2018).

Ogrodnik, M. et al. Whole-body senescent cell clearance alleviates age-related brain inflammation and cognitive impairment in mice. Aging Cell 20 , e13296 (2021).

Gasek, N. S., Kuchel, G. A., Kirkland, J. L. & Xu, M. Strategies for targeting senescent cells in human disease. Nat Aging 1 , 870–879 (2021).

Chaib, S., Tchkonia, T. & Kirkland, J. L. Cellular senescence and senolytics: the path to the clinic. Nat. Med. 28 , 1556–1568 (2022).

He, W. B., Abe, K. & Akaishi, T. Oral administration of fisetin promotes the induction of hippocampal long-term potentiation in vivo. J. Pharmacol. Sci. 136 , 42–45 (2018).

Freund, A., Laberge, R. M., Demaria, M. & Campisi, J. Lamin B1 loss is a senescence-associated biomarker. Mol. Biol. Cell 23 , 2066–2075 (2012).

Tyshkovskiy, A. et al. Distinct longevity mechanisms across and within species and their association with aging. Cell 186 , 2929–2949 (2023).

Tyshkovskiy, A. et al. Identification and application of gene expression signatures associated with lifespan extension. Cell Metab. 30 , 573–593 (2019).

Spudich, S. & Nath, A. Nervous system consequences of COVID-19. Science 375 , 267–269 (2022).

Ramani, A. et al. SARS-CoV-2 targets neurons of 3D human brain organoids. EMBO J. 39 , e106230 (2020).

Schumacher, B., Pothof, J., Vijg, J. & Hoeijmakers, J. H. J. The central role of DNA damage in the ageing process. Nature 592 , 695–703 (2021).

d’Adda di Fagagna, F. et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 426 , 194–198 (2003).

Gioia, U. et al. SARS-CoV-2 infection induces DNA damage, through CHK1 degradation and impaired 53BP1 recruitment, and cellular senescence. Nat. Cell Biol. 25 , 550–564 (2023).

Liberzon, A. et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 1 , 417–425 (2015).

Saul, D. et al. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat. Commun. 13 , 4827 (2022).

Cherry, C. et al. Transfer learning in a biomaterial fibrosis model identifies in vivo senescence heterogeneity and contributions to vascularization and matrix production across species and diverse pathologies. Geroscience https://doi.org/10.1007/s11357-023-00785-7 (2023).

Article   PubMed   Google Scholar  

Danaher, P. et al. Advances in mixed cell deconvolution enable quantification of cell types in spatial transcriptomic data. Nat. Commun. 13 , 385 (2022).

Kim, J., Matney, C. J., Blankenship, A., Hestrin, S. & Brown, S. P. Layer 6 corticothalamic neurons activate a cortical output layer, layer 5a. J. Neurosci. 34 , 9656–9664 (2014).

McCray, P. B. Jr. et al. Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. J. Virol. 81 , 813–821 (2007).

Krasieva, T. B., Ehren, J., O’Sullivan, T., Tromberg, B. J. & Maher, P. Cell and brain tissue imaging of the flavonoid fisetin using label-free two-photon microscopy. Neurochem. Int. 89 , 243–248 (2015).

Delval, L. et al. Removal of senescent cells reduces the viral load and attenuates pulmonary and systemic inflammation in SARS-CoV-2-infected, aged hamsters. Nat Aging 3 , 829–845 (2023).

Rosen, B., Kurtishi, A., Vazquez-Jimenez, G. R. & Moller, S. G. The intersection of Parkinson’s disease, viral infections, and COVID-19. Mol. Neurobiol. 58 , 4477–4486 (2021).

Xu, E., Xie, Y. & Al-Aly, Z. Long-term neurologic outcomes of COVID-19. Nat. Med. 28 , 2406–2415 (2022).

Escartin, C. et al. Reactive astrocyte nomenclature, definitions, and future directions. Nat. Neurosci. 24 , 312–325 (2021).

Nelke, C., Schroeter, C. B., Pawlitzki, M., Meuth, S. G. & Ruck, T. Cellular senescence in neuroinflammatory disease: new therapies for old cells? Trends Mol. Med. 28 , 850–863 (2022).

Chinta, S. J. et al. Cellular senescence is induced by the environmental neurotoxin paraquat and contributes to neuropathology linked to Parkinson’s disease. Cell Rep. 22 , 930–940 (2018).

Musi, N. et al. Tau protein aggregation is associated with cellular senescence in the brain. Aging Cell 17 , e12840 (2018).

Ogrodnik, M. et al. Obesity-induced cellular senescence drives anxiety and impairs neurogenesis. Cell Metab. 29 , 1061–1077 (2019).

Sepe, S. et al. DNA damage response at telomeres boosts the transcription of SARS-CoV-2 receptor ACE2 during aging. EMBO Rep. 23 , e53658 (2022).

da Silva, P. F. L. et al. The bystander effect contributes to the accumulation of senescent cells in vivo. Aging Cell 18 , e12848 (2019).

Golia, M. T. et al. Interplay between inflammation and neural plasticity: both immune activation and suppression impair LTP and BDNF expression. Brain Behav. Immun. 81 , 484–494 (2019).

Camell, C. D. et al. Senolytics reduce coronavirus-related mortality in old mice. Science https://doi.org/10.1126/science.abe4832 (2021).

Aguado, J. et al. Inhibition of the cGAS-STING pathway ameliorates the premature senescence hallmarks of Ataxia-Telangiectasia brain organoids. Aging Cell https://doi.org/10.1111/acel.13468 (2021).

Ormel, P. R. et al. Microglia innately develop within cerebral organoids. Nat. Commun. 9 , 4167 (2018).

Amarilla, A. A. et al. A versatile reverse genetics platform for SARS-CoV-2 and other positive-strand RNA viruses. Nat. Commun. 12 , 3431 (2021).

Amarilla, A. A. et al. An optimized high-throughput immuno-plaque assay for SARS-CoV-2. Front. Microbiol. 12 , 625136 (2021).

Aguado, J. et al. Inhibition of DNA damage response at telomeres improves the detrimental phenotypes of Hutchinson-Gilford Progeria Syndrome. Nat. Commun. 10 , 4990 (2019).

Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15 , 550 (2014).

Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. USA 102 , 15545–15550 (2005).

Isaacs, A. et al. Nucleocapsid specific diagnostics for the detection of divergent SARS-CoV-2 variants. Front. Immunol. 13 , 926262 (2022).

Modhiran, N. et al. A nanobody recognizes a unique conserved epitope and potently neutralizes SARS-CoV-2 omicron variants. iScience 26 , 107085 (2023).

Download references

Acknowledgements

We thank Novogene for performing bulk RNA-seq experiments and bioinformatic analysis; Aaron McClelland from NanoString for technical and computational assistance on GeoMx spatial transcriptomic sequencing; the scientists and pathologists of Queensland and New South Wales Department of Health, and Kirby Institute, for providing the SARS-CoV-2 variants; M. Patrick and B. Arnts (UQBR animal staff) at the Australian Institute for Bioengineering and Nanotechnology and C. McGirr (BSL-3 facility manager at the Institute for Molecular Bioscience for technical assistance; R. Sullivan from the Queensland Brain Institute for technical advice; J. Cridland (Regulatory Compliance Officer, Faculty of Science at UQ) and A. Jones (UQ Biosafety) for advice on biosafety approvals and BSL-3 manual and safety procedures; S. Walters, D. Knight and E. Mu from the School of Biomedical Sciences Imaging and Histology facilities (UQ) for technical support; and E.J.W., J.C.M. and D.W. laboratory members for discussions. M.S. was supported by the Berta-Ottenstein-Programme for Clinician Scientists, Faculty of Medicine, University of Freiburg and the IMM-PACT-Programme for Clinician Scientists, Department of Medicine II, Medical Center–University of Freiburg and Faculty of Medicine, University of Freiburg, funded by Deutsche Forschungsgemeinschaft no. 413517907. A.A.K. was supported by a NHMRC Ideas grant (no. 2012883) and a COVID-19 seed grant from the Australian Infectious Diseases Research Centre. G.V.N. and A.R.-F. were supported by ANID-FONDECYT (no. 1200427) and Posdoctorado Fondecyt (no. 3220635). T.M.W. was supported by NHMRC (no. 2009957). E.J.W. was supported by NHMRC and an ARC Discovery Project (no. DP210103401). J.A. was supported by the IBSA Foundation for Scientific Research, the Jérôme Lejeune Foundation, a University of Queensland Early Career Researcher Grant (application no. UQECR2058457), a NHMRC Ideas Grant (no. 2001408) and a Brisbane Children’s Hospital Foundation grant (no. Project-50308). The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Author information

These authors contributed equally: Alberto A. Amarilla, Jessica C. Mar, Daniel Watterson, Ernst J. Wolvetang.

Authors and Affiliations

Australian Institute for Bioengineering and Nanotechnology, University of Queensland, St Lucia, Queensland, Australia

Julio Aguado, Atefeh Taherian Fard, Harman K. Chaggar, Naphak Modhiran, Cecilia Gómez-Inclán, Ibrahim Javed, Alireza A. Baradar, Lianli Peng, Malindrie Dharmaratne, Giovanni Pietrogrande, Thomas P. Davis, Jessica C. Mar & Ernst J. Wolvetang

School of Chemistry and Molecular Biosciences, University of Queensland, St Lucia, Queensland, Australia

Alberto A. Amarilla, Naphak Modhiran, Benjamin Liang, Morgan E. Freney, Rhys Parry, Julian D. J. Sng, Ariel Isaacs, Alexander A. Khromykh & Daniel Watterson

School of Biomedical Sciences, Faculty of Medicine, University of Queensland, St Lucia, Queensland, Australia

Eduardo A. Albornoz & Trent M. Woodruff

Division of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA

Alexander Tyshkovskiy & Vadim N. Gladyshev

Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia

Alexander Tyshkovskiy

Institute of Neuropathology and Center for Basics in NeuroModulation, Faculty of Medicine, University of Freiburg, Freiburg, Germany

Marius Schwabenland & Marco Prinz

Centre for Pharmaceutical Innovation, School of Pharmacy and Medical Sciences, UniSA Clinical and Health Sciences, The University of South Australia, Adelaide, South Australia, Australia

Ibrahim Javed

Clem Jones Centre for Ageing Dementia Research, Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australia

Pranesh Padmanabhan

Australian Infectious Disease Research Centre, Global Virus Network Centre of Excellence, Brisbane, Queensland, Australia

Alexander A. Khromykh

Institute of Medicine, Faculty of Medicine & Center for Interdisciplinary Studies on the Nervous System, CISNE, Universidad Austral de Chile, Valdivia, Chile

Guillermo Valenzuela Nieto

Nuffield Department of Medicine, University of Oxford, Oxford, UK

Alejandro Rojas-Fernandez

Berking Biotechnology, Valdivia, Chile

Signalling Research Centers BIOSS and CIBSS, University of Freiburg, Freiburg, Germany

Marco Prinz & Bertram Bengsch

Faculty of Medicine, Clinic for Internal Medicine II, Gastroenterology, Hepatology, Endocrinology, and Infectious Disease, University Medical Center Freiburg, Freiburg, Germany

Bertram Bengsch

Broad Institute of MIT and Harvard, Cambridge, MA, USA

Vadim N. Gladyshev

You can also search for this author in PubMed   Google Scholar

Contributions

J.A., H.K.C. and G.P. generated human brain organoids. J.A., H.K.C., A.T., A.T.F., M.D., M.S., A.A.A., G.P., E.A.A., N.M., B.L., A.I., L.P., P.P., I.J., A.A.B., G.V.N., M.E.F., R.P., J.D.J.S., C.G.-I., T.M.W., J.C.M. and E.J.W. contributed to acquisition, analysis or interpretation of data. A.A.A., E.A.A., N.M. and B.L. participated in the infections and treatments of mice and monitored their clinical performance. J.A., A.T.F. and A.T. analyzed transcriptomic data. J.A., A.A.A., A.T.F., E.A.A., J.C.M. and E.J.W. contributed to experimental design. J.A. planned and supervised the project and wrote the paper. All authors edited and approved the final version of this article.

Corresponding author

Correspondence to Julio Aguado .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Peer review

Peer review information.

Nature Aging thanks the anonymous reviewers for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended data fig. 1 characterization of cellular senescence in physiologically aged human bos..

(a) Scatter plot shows the number of SA-β-gal-positive cells per organoid. Each data point in the bar graph represents a single organoid analysed. Dotted lines represent the fitted non-linear regression curve. (b) Schematic representation of experimental design that applies to Figs. 1 , 2 and to Extended Data Fig. 1b-c . 8-month-old human BOs were exposed to two doses of the senolytic treatments navitoclax (2.5 μM), ABT-737 (10 μM) or D + Q (D: 10 μM; Q: 25 μM): the first one on day 1 and the second dose on day 16. Analysis was performed at the end time point of the 1-month experiment as well as at initial timepoint of 8 months organoid culture. (c) Bar graphs show the percentage of p16-positive cells co-localising with the indicated brain cell type markers. Each data point in the bar graph represents a single organoid analysed. Data are presented as mean values ± s.d.; 3 individual organoids were analysed per condition; one-way ANOVA with Dunnett’s multiple-comparison post-hoc corrections.

Extended Data Fig. 2 Senolytic-driven transcriptomic changes in BOs and senescence single-cell analysis of postmortem human brain frontal cortex.

(a) Heat map shows senescence-associated RNA transcriptomic expression of downregulated mRNAs shared across all three senolytic interventions. (b) Functional enrichment analyses of gene expression signatures and multiple senolytic treatment of BOs. Heat map cells are coloured based on the normalized enrichment score (NES). (c) Box-and-whisker plots (Tukey’s minimum, 25th percentile, median, 75th percentile, Tukey’s maximum) shows the intensity in normalised arbitrary units (a.u.) of p16 protein. Each dot represents outlier cells of a total of 2,794,379 individual brain cells across 7 COVID-19 and 8 non-COVID-19 patients. p16-positive cells were assigned when a cell’s normalised intensity surpassed the value of 1,000.

Extended Data Fig. 3 Characterization of neurotropic SARS-CoV-2-induced senescence.

(a) Representative images of neural progenitors (Sox2), neurons (NeuN), or astrocytes (GFAP) co-stained with SARS-CoV-2 nucleocapsid protein. Human BOs were 3 month-old at time of infection with the indicated SARS-CoV-2 variants at MOI 1 and collected at 5dpi. Scale bar, 50 µm. One representative experiment out of two is shown. (b) Stacked bar graphs show quantifications from a . (c,d) Microglia-containing organoids were generated as previously described 56 , these organoids were matured for 3 months prior to SARS-CoV-2 infection at MOI 1 and collected at 5dpi. (c) Representative images of microglia (Iba1) co-stained with SARS-CoV-2 nucleocapsid protein. Scale bar, 50 µm. (d) Stacked bar graphs show quantifications from c . (e) Bar graphs show the percentage of p16- and p21-positive cells. Each data point in the bar graph represents a single organoid (n = 5-8) analysed at 5dpi. Data are presented as mean values ± s.d.; one-way ANOVA with Dunnett’s multiple-comparison post-hoc corrections. (f) Representative images of p16 and p21 co-stained with SARS-CoV-2 nucleocapsid and spike proteins. Scale bar, 50 µm. (g) Bar graphs show the percentage of SA-β-gal-positive cells. Each data point in the bar graph represents a single organoid (n = 9-29) analysed at 5 and 10dpi. Data are presented as mean values ± s.d.; one-way ANOVA with Dunnett’s multiple-comparison post-hoc corrections. (h) Total RNA from individual organoids infected with the indicated SARS-CoV-2 variants was used to quantify the indicated levels of viral RNAs and normalized to RPLP0 mRNA and compared to infected organoids at 1dpi. Error bars represent s.e.m.; n = 3 independent organoids; one-way ANOVA with multiple-comparison post-hoc corrections. (i) Bar graphs show the percentage of p16- and p21-positive cells within SARS-CoV-infected cells, and distal ( > 150 µm) and proximal ( < 150 µm) uninfected cells to SARS-CoV-2 infected cells positive for p16. Each data point in the bar graph represents a single organoid analysed. Data are presented as mean values ± s.d.; 3 individual organoids were analysed per condition; two-way ANOVA with multiple-comparison post-hoc corrections.

Extended Data Fig. 4 Transcriptional characterization of virus-induced senescence.

(a) Venn diagram on the left shows 485 differentially expressed genes shared across SARS-CoV-2-infected organoids and postmortem brains of COVID-19 patients defined with a significance adjusted P < 0.05 and log 2 FC > 0. On the right panel, bar graph indicates the pathways enriched within this 485-gene cohort. Gene Set Enrichment Analysis was carried out using aging hallmark gene sets from the Molecular Signature Database. The statistically significant signatures were selected (P < 0.05, FDR < 0.25). (b) Volcano plots show uninfected versus either Wuhan or Delta-infected brain organoid differential expression of upregulated (blue) and downregulated (red) RNAs (P < 0.05, log 2 FC > 0). DEG analysis was performed from whole-organoid RNA-seq data and p16-positive senescent-cell regions of interest (ROIs) from NanoString spatial transcriptomic sequencing. (c) Representative images of SARS-CoV-2 nucleocapsid protein immunoreactivity on BOs infected with the indicated SARS-CoV-2 variants and analysed at 5 days post infection. Scale bar, 500 µm. (d) Bar graph shows quantifications of nucleocapsid-positive cells from BOs (n = 4-8) uninfected and infected with the indicated SARS-CoV-2 variants and analysed at 5 dpi. Each data point in the bar graph represents a single organoid analysed. Data are presented as mean values ± s.d.; one-way ANOVA with multiple-comparison post-hoc corrections. (e) SenSig senescence signature heat map gene expression of Delta-infected p16-positive cells.

Extended Data Fig. 5 Effects of senolytic administration prior to SARS-CoV-2 infection.

(a) Principal component analysis from NanoString spatial transcriptomic sequencing of p16-positive cells in the subspace defined by these differentially-expressed genes showing clustering of uninfected and Wuhan-infected human BOs away from the Delta-infected counterparts. (b) Total RNA from individual organoids uninfected or infected with the SARS-CoV-2 Delta variant was used to quantify Lamin B1 and p21 mRNA expression levels and normalized to RPLP0 mRNA and compared to infected vehicle controls. Data are presented as mean values ± s.d.; n = 3 independent organoids; one-way ANOVA with multiple-comparison post-hoc corrections. (c) Schematic representation of experimental design that applies to d . Human BOs were exposed to the indicated senolytic treatments for 5 days and subsequently SARS-CoV-2-infected at multiplicity of infection 1 for 5 additional days. Analysis was performed at the end time point of the 10-day experiment. (d) SA-β-gal activity was evaluated at 10 days post infection. Bar graphs show the percentage of SA-β-gal-positive cells. Each data point in the bar graph represents a single organoid (n = 6-17) analysed. Data are presented as mean values ± s.d.; one-way ANOVA with multiple-comparison post-hoc corrections.

Extended Data Fig. 6 Senolytics delay weight loss and reduce lung senescence in SARS-CoV-2-infected K18-hACE2 mice.

(a) Representative immunofluorescent images of viral nucleocapsid (NC) antigen in whole brain coronal sections of brains from SARS-CoV-2-infected K18-hACE2 transgenic mice (5 days post infection). CTX: Cerebral cortex; BS: Brainstem. (b) Percentage weight loss up to 7 days post infection. Uninfected mice (n = 3), and Delta SARS-CoV-2-infected mice treated with vehicle (n = 6), fisetin (n = 8), D + Q (n = 8), or navitoclax (n = 8). Error bars represent s.d. (c) Total RNA of individual lungs from mice uninfected or infected with the SARS-CoV-2 Delta variant and treated with various senolytic interventions was used to quantify the mRNA expression levels of the indicated senescence and SASP RNAs and was normalized to Rplp0 mRNA. Each column in the heatmap represents an individual mouse lung analysed.

Supplementary information

Reporting summary, supplementary code 1..

Pipeline for analysis of SA-β-gal-positive cells.

Supplementary Table 1.

Sequences of oligonucleotides used in the present study.

Source Data Fig. 1.

Statistical source data for Fig. 1.

Source Data Fig. 2.

Statistical source data for Fig. 2.

Source Data Fig. 3.

Statistical source data for Fig. 3.

Source Data Fig. 4.

Statistical source data for Fig. 4.

Source Data Fig. 5.

Statistical source data for Fig. 5.

Source Data Fig. 6.

Statistical source data for Fig. 6.

Source Data Extended Data Fig. 1.

Statistical source data for Extended Data Fig. 1.

Source Data Extended Data Fig. 2.

Statistical source data for Extended Data Fig. 2.

Source Data Extended Data Fig. 3.

Statistical source data for Extended Data Fig. 3.

Source Data Extended Data Fig. 4.

Statistical source data for Extended Data Fig. 4.

Source Data Extended Data Fig. 5.

Statistical source data for Extended Data Fig. 5.

Source Data Extended Data Fig. 6.

Statistical source data for Extended Data Fig. 6.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and Permissions

About this article

Cite this article.

Aguado, J., Amarilla, A.A., Taherian Fard, A. et al. Senolytic therapy alleviates physiological human brain aging and COVID-19 neuropathology. Nat Aging (2023). https://doi.org/10.1038/s43587-023-00519-6

Download citation

Received : 09 March 2023

Accepted : 03 October 2023

Published : 13 November 2023

DOI : https://doi.org/10.1038/s43587-023-00519-6

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

• Open access
• Published: 28 November 2023

A global bibliometric and visualized analysis of the status and trends of gastroparesis research

• Meng Li   ORCID: orcid.org/0000-0002-9207-2129 1   na1 ,
• Ning Gao   ORCID: orcid.org/0000-0002-8402-3108 2   na1 ,
• Shaoli Wang 1 ,
• Yufeng Guo 2 &
• Zhen Liu 1  

European Journal of Medical Research volume  28 , Article number:  543 ( 2023 ) Cite this article

Metrics details

Gastroparesis has a substantial impact on the quality of life but has limited treatment options, which makes it a public health concern. No bibliometric studies on gastroparesis have been published thus far. Thus, this article aims to summarize and analyze research hotspots to provide a reference for clinical researchers.

Materials and methods

Gastroparesis-related research articles were searched in the Web of Science Core Collection (WOSCC), and relevant information was extracted after screening. A total of 1033 documents were analyzed with the bibliometric method using Microsoft Excel, Citespace, and VOSviewer.

Overall, our search retrieved 1033 papers contributed by 966 research institutions from 53 countries. Since 1980, publications in this field have increased rapidly. United States ( n  = 645) and Temple University ( n  = 122) were the most productive country and institution, respectively. Parkman, with 96 publications, was the most prominent author.

Conclusions

Research hotspots in gastroparesis can be summarized into four domains: innovation in diagnostic modalities, change of oral therapeutic agents, choice of surgical interventions, and pathological mechanisms. Future research on gastroparesis should focus on the quality of life of patients, diagnostic techniques, pyloromyotomy, and transpyloric stent placement.

Introduction

Gastroparesis is a syndrome characterized by delayed gastric emptying (DGE) in the absence of mechanical gastric obstruction [ 1 ]. Common symptoms include nausea, vomiting, postprandial fullness, and abdominal distention [ 2 ]. About 72% of patients with gastroparesis present with abdominal pain, which is easily overlooked in clinical practice. However, some patients have more insidious symptoms or no discomfort [ 3 ]. Epidemiological surveys have shown that the prevalence rate is 13.8 per 100,000 people in the UK [ 4 ] and 24.2 per 100,000 people in the US [ 5 ]. Nevertheless, in clinical practice, the accurate prevalence of gastroparesis is difficult to determine: only one in nine patients with high-probability gastroparesis receives an accurate diagnosis [ 6 ]. Both gastroparesis and functional dyspepsia are gastric neuromuscular disorders, and because of the similarity of their symptoms, they are often confused with each other [ 7 ]. The current understanding of the etiology of gastroparesis recognizes three main types of gastroparesis: idiopathic gastroparesis (IG), diabetic gastroparesis (DG), and postoperative gastroparesis (PG) [ 8 ]. IG is the most common type of gastroparesis, predominantly affecting female patients [ 9 ]. Patients with DG account for about one-third of all cases of gastroparesis [ 10 ]. Hyperglycemia has been reported to increase the risk of gastroparesis, which occurs within 10 years of diagnosis in about 5.2% of patients with type 1 diabetes and a lower percentage of those with type 2 diabetes [ 11 ]. In addition, there is a link between gastroparesis and Parkinson’s disease [ 10 ]. Although the exact pathogenesis of gastroparesis has not yet been fully understood, it is thought to involve the loss of vagal nerve and interstitial cell function [ 12 ]. Gastroparesis reduces patients' quality of life and places a significant financial burden on the healthcare system [ 13 ].

Bibliometrics is a quantitative method of analyzing the characteristics and trends of research in a given field using previously published academic literature; it was first introduced by Pritchard in 1969 [ 14 ]. This method has been widely employed in the fields of information science, chemistry, and physics and has new potential in medicine [ 15 ]. No such research that reviews and analyzes the existing research results in the field of gastroparesis has been published so far. An assessment of the current state of research in the gastroparesis field is necessary.

Based on the above information, this study aims to solve the following questions:

What are the annual trends of publications in the field of gastroparesis?

Which countries, authors, and institutions focus on and contribute the most to the field of gastroparesis?

Which journals are more willing to publish articles on gastroparesis?

What are the hot research topics in the field of gastroparesis and where are the future research prospects likely to emerge?

Through this study, we hope to help provide essential learning resources for clinicians and investigators less familiar with the field, as well as gain insight into new perspectives and foundations for the future in gastroparesis research.

Data sources and search strategies

Web of Science (WOS) is the earliest, most comprehensive, and most detailed database in the world [ 16 ], and it has had a significant impact in the biomedical field [ 17 ]. We conducted a search for all publications in the gastroparesis field in the Science Citation Index-Expanded (SCIE) database in the WOS Core Collection (WOSCC), for the period spanning from database inception to November 16, 2022. The search terms were formulated based on the clinical experience, medical subject headings (MeSH), and published articles [ 18 , 19 ], and a title search was finally performed on the retrieved articles to avoid the inclusion of a large number of unrelated articles [ 20 , 21 , 22 ]. The search formula was finally set as follows: TI = (Gastropares*) OR TI = (Gastric Stas*). The language of the article was limited to English, and the type of article was set to either research or review. Two researchers (ML and NG) independently performed the data search, and any differences in opinions were resolved by discussion. On screening the retrieved articles with the selection criteria, 1033 publications in the field of gastroparesis were finally included in the analysis (Fig.  1 ).

Flow chart of literature screening

Data collection

Data regarding the following parameters were downloaded from WOSCC for the publications identified: title, author, journal, institution, publication year, and keywords. The data were exported in plain text format. Impact factor (IF) and journal citation report (JCR) category were obtained through JCR Science Edition (2021) [ 17 ]. To avoid bias caused by database updates, data retrieval and export were chosen to be completed on the same day (November 16, 2022).

Statistical analysis

Analyses of descriptive statistics for countries, institutions, authors, journals, citations, and keywords were performed using Microsoft Excel (Version 2019; Microsoft Corporation; Washington, United States) [ 23 ] to produce world heat maps, line graphs, and bar charts. In addition, visual graphs of collaboration networks and keyword clusters were constructed using the VOSviewer (Version 1.6.18; Leiden University; Leiden, Netherlands), which was developed by Van Eck and Waltman at Leiden University in the Netherlands. In the cooperation network, the number of publications determines the size of the node, the connection between nodes indicates the cooperation relationship, and the thickness of the connection reflects the strength of the cooperation [ 24 ]. Keyword burst analysis was performed using CiteSpace (Version V; Drexel University; Pennsylvania, United States), to determine the research hotspots and frontier trends from the time dimension [ 25 ]. The software parameters were set as follows: time slice (1990–2022), years per slice (1), and selection strategy (g-index, k  = 25) [ 26 ].

In addition, the following indicators were used to examine the output and quality of publications in this study: (1) total publications (TP): total number of publications during the observation period; (2) total citations (TC): total citations of publications; (3) TC/TP: average number of citations per publication (CPP).

Publication outputs and citation trend

After applying the defined search formula and screening criteria, 1033 publications, including 888 articles (85.96%) and 145 reviews (14.04%), were extracted. Figure  2 shows the annual trends in the number of publications and citations, and the annual growth curve of publications was expressed as a mathematical function ( y  = 1.0613e 0.0808x ). The calculated R 2 of 0.9009 suggested a strong correlation between the number of annual publications and the year of publication [ 24 ]. The first article in this field was authored by Kassander and published in 1958 under the title “Gastroparesis” in Annals of Internal Medicine [ 27 ]. Between 1958 and 1987, articles were published intermittently, with the annual number of articles being less than 10; subsequently, the annual number of publications increased and peaked at 67 in 2021. A similar upward trend was also seen in the annual citations since 1979 and peaked in 2013 ( n  = 2174). These findings indicate that research in the gastroparesis field is gaining attention and will continue to grow in the coming years.

Annual number of the published publications in gastroparesis research

Contributions of countries

Fifty-three countries or regions participated in gastroparesis-related publications. The USA was the highest contributor, accounting for 645, i.e., 62.44%, of the total publications, which was significantly greater than the contributions of other countries. USA was followed by China ( n  = 86), Australia ( n  = 40), and Belgium ( n  = 38). The country that ranked first in terms of CPP value was Belgium ( n  = 79.47), indicating the high quality of the published research as well as the reference value of the country (Table 1 ).

Regional differences in the gastroparesis research field were observed worldwide, with a higher participation from North America, Western Europe, and East Asia (Fig.  3 A). The USA was found to be at the center of the cooperation network, maintaining cooperation with 34 countries (Fig.  3 C). Although an annual increase was noted in the participation of China and Australia during the recent years, these countries may still have some potential for enhanced cooperation, considering the USA’s long-standing participation and contribution (Fig.  3 B).

The distribution of countries in gastroparesis research. A Distribution of gastroparesis publications in the world map. According to the color gradient in the lower right corner, the color of each country represents the amount of literature published. B The distribution trend of the top 3 countries by year. C Overlay visualization map of co-authorship among countries

Contributions of institutions

In all, 966 institutions were involved in publishing in the gastroparesis field, with Temple University contributing 122 publications and accounting for 11.81% of the total publications, a number significantly greater than that of any other institution, followed by Mayo Clinic ( n  = 103), Texas Tech University ( n  = 65), and University of Louisville ( n  = 62) (Table 2 ). Among them, Mayo Clinic was at the center of the collaborative network, maintaining collaborative relationships with 41 institutions; the closest relationship was with Temple University, with the two institutions collaborating over a total of 52 publications (Fig.  4 ).

Overlay visualization map of co-authorship among institutions with five or more publications

Journal analysis

Research in the field of gastroparesis has been published in 324 journals. Table 3 shows the ten journals with the highest number of articles, covering 397 articles, i.e., 38.43% of the total number of articles. Neurogastroenterology & Motility published the most articles ( n  = 89), followed by Digestive Diseases and Sciences ( n  = 83), American Journal of Gastroenterology ( n  = 40). Among the publishing journals, Gastroenterology (IF = 33.88) had the highest IF, while three journals, namely, American Journal of Gastroenterology , Gastrointestinal Endoscopy , and Clinical Gastroenterology and Hepatology, have IF scores above 10. In addition, six journals belonged to the Q1 category, which indicates that research in the gastroparesis field has attracted the attention of many high-quality journals.

Contributions of authors

The data analysis revealed that 3879 researchers have been involved in the research on gastroparesis. Among them, Parkman contributed 96 publications, accounting for 9.29% of the total publications, followed by Abell ( n  = 52), McCallum ( n  = 51), and Farrugia ( n  = 43) (Table 4 ). In addition, numerous tight-knit research teams have been formed in this field, such as the Farrugia, Pasricha, and Koch team from Temple University, which has contributed to 33 publications pertaining to a wide range of studies involving drug efficacy evaluation [ 28 , 29 ] and analysis of relevant factors [ 30 , 31 ] (Fig.  5 ).

Network visualization map of authors with five or more publications

Highly cited papers tend to have a significant impact in a particular field [ 32 ] and reflect the hot spots and depth of research in the field [ 33 ]. In the context of gastroparesis, the article “Improvement of gastric emptying in diabetic gastroparesis by erythromycin: Preliminary studies” published by Janssens in 1990 is the most cited article. This was also the first paper to examine the value of erythromycin in the treatment of DG. The study revealed that erythromycin shortened the gastric emptying time to normal for both liquids and solids, thus providing important evidence for the clinical application and further study of erythromycin [ 34 ]. The publications that are ranked second and third in terms of citations are both academic guidelines, with the 2004 article “American Gastroenterological Association technical review on the diagnosis and treatment of gastroparesis” being the first national-level guideline in the field of gastroparesis, offering detailed information on the diagnosis and treatment of the disease. The 2013 article “Clinical guideline: management of gastroparesis” further improved the previous guidelines based on the latest research findings. For example, this article clarifies the three main causes of gastroparesis, and nutritional maintenance and glycemic control have been added to the treatment. In addition, the epidemiological characteristics of the disease [ 10 , 35 ] and the efficacy of gastric electrical stimulation (GES) [ 36 , 37 ] are also focus points for researchers in the field of gastroparesis (Table 5 , Fig.  6 A). In addition, co-citation analysis was performed, and the results are shown in Table 6 and Fig.  6 B.

The distribution of citations in gastroparesis research. A Network visualization map of citation among documents. B Network visualization map of co-citation among documents

Keywords analysis

Research hotspots: co-occurrence and clustering analysis of keywords.

High-frequency keywords represent popular topics in a research field [ 38 ]. In the current study, 2487 keywords were included. Fifty of these keywords were used at least 15 times. Table 7 shows the top 20 keywords in terms of frequency. Based on the keyword co-occurrence network, the keywords can be divided into five clusters, according to the color (Fig.  7 ): Cluster 1 (red), diagnostic methods; Cluster 2 (blue), surgical interventions; Cluster 3 (green), pathological mechanism; Cluster 4 (yellow), pharmacological intervention; and Cluster 5 (purple), others, involving “acid breath test,” “botulinum toxin injection,” “double-blind,” etc.

Co-occurrence network visualization map of keyword

Research fronts: keyword burst analysis

Keyword burst analysis is used to determine the evolution of research hotspots by analyzing the temporal change characteristics in burst words [ 39 ]. Figure  8 shows the top 20 keywords in terms of burst intensity for the period of 1990–2022. The strongest keyword is pyloromyotomy (8.89), and the keyword with the longest burst duration is cisapride (1997–2006). Furthermore, the keywords that continue to explode until 2022 are quality of life, pyloromyotomy, transpyloric stent placement, and diagnosis, which are areas of cutting-edge research in the field of gastroparesis.

Top 20 keywords with the strongest citation bursts

In this study, we used the bibliometric method and retrieved 1033 publications related to gastroparesis from the WOSCC database. We analyzed the contributions of countries, institutions, authors, and journals in the gastroparesis field and summarized the research hotspots and future directions. Our search revealed that 53 countries, 966 institutions, 3879 authors, and 324 journals are involved in research in the field of gastroparesis. The United States undoubtedly occupies the leading position, both in terms of the volume of articles published and international collaborations, and it is an important initiator and promoter of gastroparesis-related research. The Temple University, with its research team represented by Farrugia, Pasricha, and Koch, has produced the highest number of articles, making it a regional research center.

A combined analysis of keyword frequency and keyword clustering reveals that the research hotspots mainly revolve around four areas: innovation in diagnostic modalities, change of oral therapeutic agents, choice of surgical interventions, and pathological mechanism. From the analysis of keyword bursts, it can be predicted that future research will mainly be focused on quality of life, diagnostic techniques, pyloromyotomy, and transpyloric stent placement.

Innovation in the diagnostic approach

The diagnosis of gastroparesis is based on three parameters: (1) symptoms of dyspepsia associated with gastroparesis; (2) absence of abnormalities on gastroscopy; and (3) evidence of the occurrence of DGE [ 40 , 41 ]. Questionnaires, such as the Gastroparesis Cardinal Symptom Index (GCSI) [ 42 ] and the GCSI-Daily Diary (GCSI-DD), have been developed to quantify the severity of symptoms. Gastric emptying scintigraphy (GESc) is currently the diagnostic tool most commonly used for the detection of DGE; in addition, wireless motion capsules (WMC) and gastric emptying breath test (GEBT) have also been clinically validated for their diagnostic value [ 43 ].

In GESc, a gamma camera is used to detect the migration of radioisotopes, thereby reflecting the transport characteristics of substances in the gastrointestinal tract [ 44 ]. The use of GESc for the investigation of gastroparesis patients was first proposed in 1966 [ 45 ]. Because it provides an objective measure of gastric emptying (GE) [ 46 ] and offers the advantage of being noninvasive, it has now become the gold standard for the diagnosis of gastroparesis [ 47 ]. However, previously, the test lacked standardization due to variations in the food taken and the duration of imaging [ 48 ]. This concern was overcome in 2008, when the American Neurogastroenterology and Motility Society and the Society of Nuclear Medicine published the world’s first consensus recommendations on GESc [ 49 ], detailing the steps to be taken before and after the examination. In particular, these recommendations provide detailed descriptions of the food composition and ratio of the GE meal, the time and angle of the shot, and the normal values of the parameters’ investigations during the examination. However, low compliance with the GES consensus recommendations is still very common and is a major cause of the underdiagnosis and misdiagnosis of gastroparesis [ 50 ]. In addition, some patients may not be able to tolerate solid food [ 51 ], and some studies have even shown that liquid GE studies have greater diagnostic value when compared to GE studies with solid food [ 52 ]. All these discrepancies have caused considerable problems for the clinical application of GESc.

GESc is not recommended in certain populations, such as children and pregnant women, because of the risk associated with radiation exposure [ 53 ]. The procedure also takes a long time per patient, making the test inefficient [ 54 ]. Thus, GEBT has become a safe and effective alternative [ 55 ]. GEBT is easy to operate, can be performed anywhere, and can be transferred to the field for analysis [ 56 ]. In 1993, Ghoos et al. [ 57 ] first detected the GE rate by carbon-labeled octanoic acid breath test. Their study creatively proposed three parameters for analysis, namely, GE coefficient, gastric half-emptying time, and stagnation period, and also established GEBT as a reliable and noninvasive test. However, patients with combined diabetes or scleroderma may have false-negative results with GEBT [ 58 ]. Another limitation of GEBT is that it does not allow for the identification of the specific area of injury [ 59 ]. Apart from GESc and GEBT, WMC is a commonly used technique for assessing gastrointestinal dynamics [ 44 ]. The WMC sensor allows for continuous data collection of pH, pressure, and temperature of the gastrointestinal tract for up to 5 days [ 60 ]. A study comparing GESc and WMC in gastroparesis assessment suggests that GESc has higher sensitivity, sensitivity, and specificity [ 61 ]. However, WMC has a higher diagnostic rate and also identifies abnormalities in extragastric transport [ 62 ].

Change of oral therapeutic agents

With regard to the management of gastroparesis, there is a lack of effective therapeutic medications. Although there are a limited number of clinical studies suggesting superior efficacy of dopamine antagonists over placebo, most of these studies were conducted more than 20 years ago [ 63 ]. Thus far, metoclopramide is the only drug approved for marketing in the United States for the treatment of gastroparesis [ 64 ]. Metoclopramide is a dopamine receptor antagonist [ 65 ] that has antiemetic properties along with prokinetic activity [ 66 ]. Its therapeutic efficiency has been confirmed by clinical studies [ 67 , 68 ]. The dosage form of metoclopramide was upgraded from a tablet to a nasal spray, to prevent vomiting associated with oral intake; this change did not result in any significant decrease in efficacy, although there were gender differences in effects [ 69 ]. Nevertheless, the adverse effects of the drug continue to be reported. For example, a study of 34,685 diabetic patients treated with metoclopramide found that the risk of Parkinson’s syndrome increased with the duration of treatment, regardless of whether or not the drug was used for more than 3 months [ 70 ]. In fact, in 2009, the USA Food and Drug Administration (FDA) issued a warning that metoclopramide use may lead to irreversible delayed-onset dyskinesia [ 71 ]. Dopamine receptor antagonists commonly used in clinical practice also include domperidone [ 72 ] and levosulpiride [ 73 ]. Another class of drugs used to treat gastroparesis comprises the 5-hydroxytryptamine-4 (5-HT4) receptor agonists [ 74 ]. However, non-specific 5-HT4 receptor agonists tend to cause cardiac conduction abnormalities [ 75 ], which was a major reason for the withdrawal of cisapride from the US market in 2000 [ 76 ]. Prucalopride is highly specific for the 5HT4 receptor, making it safer than earlier 5-HT4 receptor agonists [ 77 ]. In a 4-week randomized controlled trial, gastroparesis patients treated with prucalopride showed better GE and significant improvement in symptoms, quality of life, and survival, with only three patients developing adverse effects such as nausea and vomiting [ 78 ]. Aprepitant is a neurokinin-1 receptor (NK1R) antagonist previously used for the prevention and treatment of chemotherapy and postoperative nausea [ 29 ]. Although current evidence does not show a positive effect of aprepitant on accelerating GE [ 79 ], some case reports suggest that aprepitant may be useful in the short term to relieve nausea and vomiting in patients with gastroparesis, while awaiting further evaluation and treatment [ 80 ].

Choice of surgical interventions

Medication is often slow to take effect, with one-third of patients showing no improvement until 1 year after the intervention [ 81 ]. The adverse effects of medications also affect the compliance of patients [ 82 ]. High-frequency GES is being used as a treatment option for medically refractory gastroparesis [ 83 ]. As early as 1963, Bilgutay Am et al. hypothesized that gastrointestinal motility could be induced by electrical stimulation, in analogy to myocardial electrical stimulation for heart block. This was confirmed by experiments in dogs [ 84 ]. Since then, animal and clinical trials have been carried out to elucidate the characteristics of the electrical activity of the gastric muscle as well as the optimal frequency and duration of stimulation required [ 85 , 86 ]. The clinical use of low-frequency pulses is limited by their high power consumption. Therefore, currently, high-frequency pulses are the main form of electrical pulses used in GES [ 87 ]. Despite this, the practical application of theory is very difficult. The first GES system, Enterra™ (Medtronics, USA), was not approved by the USA FDA until 2000. To date, this device remains the only one of its kind [ 88 ]. A 1-cm-long electrode is surgically placed 10 cm proximal to the pylorus, and the wire is connected to an implanted generator to deliver high-frequency electrical pulses to the stomach, with an amplitude of 5 mA at intervals of 72 ms [ 89 ]. A recent meta-analysis suggests that GES treatment significantly improves the frequency of vomiting, gastrointestinal symptoms, and quality of life in patients [ 90 ]. A 10-year follow-up found that patients showed significant weight gain after GES, and J-tubes of 89% of the patients could be removed [ 91 ]. McCallum et al [ 92 ] suggest that GES may be achieved by activating vagal afferent pathways and that it should not be understood simply as “pacing.” GES thus represents a therapeutic option for patients with refractory gastroparesis. However, due to its high cost and invasive nature, the choice of GES for a given patient should be made with great caution [ 93 ].

Gastric per oral endoscopic esophageal myotomy (G-POEM) is a recently developed surgical treatment technique. This technique was derived from the successful operation used for the treatment of esophageal achalasia by Inoue et al [ 94 ]. Later, in 2013, Mouen A Khashab et al. [ 95 ] were the first to report the use of G-POEM for the treatment of gastroparesis. Intraoperative investigation indicates that the length of myotomy was usually shorter than that of cardia achalasia, usually between 1.5 and 2 cm [ 96 ]. A meta-analysis of 332 patients treated with G-POEM found a clinical success rate of 75.8% and 85.1%, as determined by GCSI and GES results, respectively [ 97 ]. Intraoperative complication rates of G-POEM can reach 5.1%, with postoperative complication rates of 6.8% [ 98 ]. The rate of improvement in GCSI appeared to decrease with an increase in the duration of postoperative follow-up, but remained above 50% at 1 year postoperatively [ 99 ]. Meanwhile, the mean duration of surgery and hospitalization was significantly lower in G-POEM compared with pyloromyotomy/pyloroplasty. [ 100 ]

A neurotoxic protein produced by Clostridium botulinum [ 101 ], botulinum toxin, affects cholinergic nerve contractility at low doses and inhibits acetylcholine release. Intrapyloric botulinum toxin A injection (IPBTI) is administered to resolve the imbalance between acetylcholine and nitric oxide [ 102 ] levels, thereby relieving pyloric spasm in patients with gastroparesis [ 103 ]; this is because pyloric spasm is thought to be a possible contributing factor to the development of DG [ 104 ]. However, although several reports suggest the efficacy of IPBTI [ 105 , 106 ], a systematic review of pertinent reports yielded contradictory results, highlighting the low quality of studies currently conducted around IPBTI [ 107 ].

The epidemiology of gastroparesis

In addition to the above research hotspots, we found that epidemiological terms such as quality of life and prevalence also appeared as high-frequency keywords. The Rome Foundation Global Epidemiology Study (RFGES) is a large clinical study involving 33 countries and 73,076 subjects, with research findings published in Gastroenterology in 2021. It assessed the prevalence and burden of functional gastrointestinal disorders by providing the Rome IV Diagnostic Questionnaire and an 80-item supplemental questionnaire [ 108 ]. Huang et al. used the RFGES database to further analyze and obtain epidemiological evidence on the gastroparesis-like symptoms (GPLS) population. The global prevalence of GPLS was found to be 0.9% in general, with higher prevalence in the United States, Italy, Brazil, Russia, Canada, South Korea, and China than in other countries, which is consistent with the results of the country contribution of our study. In addition, GPLS patients often present an overlap of symptoms with epigastric pain syndrome or irritable bowel syndrome, which explains why functional dyspepsia ranked the third in the frequency of keywords [ 2 ].

There are some limitations to this study. First, the literature search is limited to the WOSCC database, and although WOSCC can cover the majority of studies in the field of gastroparesis, there may still be individual qualified literature excluded. Second, as the database is dynamically updated, our study should be updated at the same time. Third, non-English publications are excluded, which may lead to retrieval incompleteness.

The number of publications on gastroparesis has steadily increased over the last four decades. The USA, Temple University, and Parkman were the most productive country, institution, and author respectively. Neurogastroenterology & Motility published the most articles. These publications have mainly covered four major domains, namely, innovation in diagnostic modalities, change of oral therapeutic agents, choice of surgical interventions, and pathological mechanisms. Future research on gastroparesis should focus on the quality of life of patients, diagnostic techniques, pyloromyotomy, and transpyloric stent placement.

Availability of data and materials

Data is available upon reasonable request.

Abbreviations

5-Hydroxytryptamine-4

Number of citations per publication

Diabetic gastroparesis

Delayed gastric emptying

Food and drug administration

Gastroparesis cardinal symptom index

GCSI-daily diary

Gastric emptying

Gastric emptying breath test

Gastric electrical stimulation

Gastric emptying scintigraphy

Gastroparesis-like symptoms

Gastric per oral endoscopic esophageal myotomy

Impact factor

Idiopathic gastroparesis

Intrapyloric botulinum toxin a injection

Journal citation report

Medical subject headings

Neurokinin-1 receptor

Postoperative gastroparesis

Rome Foundation Global Epidemiology Study

Science citation index-expanded

Total citations

United Kingdom

United States of America

Total publications

Wireless motion capsules

Web of science

The WOS Core Collection

Camilleri M, Bharucha AE, Farrugia G. Epidemiology, mechanisms, and management of diabetic gastroparesis. Clin Gastroenterol Hepatol. 2011;9(1):5-e7.

Article   Google Scholar  

Huang IH, Schol J, Khatun R, Carbone F, Van den Houte K, Colomier E, et al. Worldwide prevalence and burden of gastroparesis-like symptoms as defined by the united European gastroenterology (UEG) and European society for neurogastroenterology and motility (ESNM) consensus on gastroparesis. United Eur Gastroenterol J. 2022;10(8):888–97.

Kim KH, Lee MS, Choi TY, Kim TH. Acupuncture for symptomatic gastroparesis. Cochrane Database Syst Rev. 2018;12(12): CD009676.

Google Scholar  

Ye Y, Jiang B, Manne S, Moses PL, Almansa C, Bennett D, et al. Epidemiology and outcomes of gastroparesis, as documented in general practice records, in the United Kingdom. Gut. 2021;70(4):644–53.

Jung HK, Choung RS, Locke GR 3rd, Schleck CD, Zinsmeister AR, Szarka LA, et al. The incidence, prevalence, and outcomes of patients with gastroparesis in Olmsted County, Minnesota, from 1996 to 2006. Gastroenterology. 2009;136:1225–33.

Rey E, Choung RS, Schleck CD, Zinsmeister AR, Talley NJ, Locke GR 3rd. Prevalence of hidden gastroparesis in the community: the gastroparesis “iceberg.” J Neurogastroenterol Motil. 2012;18:34–42.

Article   PubMed Central   Google Scholar  

Kim BJ, Kuo B. Gastroparesis and functional dyspepsia: a blurring distinction of pathophysiology and treatment. J Neurogastroenterol Motil. 2019;25(1):27–35.

Hasler WL. Gastroparesis. Curr Opin Gastroenterol. 2012;28(6):621–8.

Parkman HP, Yates K, Hasler WL, Nguyen L, Pasricha PJ, Snape WJ, et al. Clinical features of idiopathic gastroparesis vary with sex, body mass, symptom onset, delay in gastric emptying, and gastroparesis severity. Gastroenterology. 2011;140(1):101–15.

Soykan I, Sivri B, Sarosiek I, Kiernan B, McCallum RW. Demography, clinical characteristics, psychological and abuse profiles, treatment, and long-term follow-up of patients with gastroparesis. Dig Dis Sci. 1998;43(11):2398–404.

Article   CAS   Google Scholar  

Choung RS, Locke GR 3rd, Schleck CD, Zinsmeister AR, Melton LJ 3rd, Talley NJ. Risk of gastroparesis in subjects with type 1 and 2 diabetes in the general population. Am J Gastroenterol. 2012;107(1):82–8.

Cipriani G, Gibbons SJ, Miller KE, Yang DS, Terhaar ML, Eisenman ST, et al. Change in populations of macrophages promotes development of delayed gastric emptying in mice. Gastroenterology. 2018;154(8):2122-2136.e12.

Lacy BE, Crowell MD, Mathis C, Bauer D, Heinberg LJ. Gastroparesis: quality of life and health care utilization. J Clin Gastroenterol. 2018;52(1):20–4.

Chen C. Science mapping: a systematic review of the literature. J Inf Sci. 2017;2:1–40.

CAS   Google Scholar  

Van Eck NJ, Waltman L. Software survey: VOSviewer, a computer program for bibliometric mapping. Scientometrics. 2010;84(2):523–38.

Aghaei Chadegani A, Salehi H, Yunus MM, Farhadi H, Fooladi M, Farhadi M, et al. A Comparison between two main academic literature collections: Web of Science and Scopus databases. Asian Soc Sci. 2013;9(5):18–26.

Feng XW, Hadizadeh M, Zheng LH, Li WH. A bibliometric and visual analysis of exercise intervention publications for Alzheimer’s disease (1998–2021). J Clin Med. 2022;11(19):5903.

Article   CAS   PubMed Central   Google Scholar  

Ma S, Guo X, Wang C, Yin Y, Xu G, Chen H, et al. Association of Barrett’s esophagus with Helicobacter pylori infection: a meta-analysis. Ther Adv Chronic Dis. 2022;13:20406223221117972.

Eusebi LH, Telese A, Cirota GG, Haidry R, Zagari RM, Bazzoli F, et al. Effect of gastro-esophageal reflux symptoms on the risk of Barrett’s esophagus: a systematic review and meta-analysis. J Gastroenterol Hepatol. 2022;37(8):1507–16.

Memon AR, Vandelanotte C, Olds T, Duncan MJ, Vincent GE. Research combining physical activity and sleep: a bibliometric analysis. Percept Mot Skills. 2020;127(1):154–81.

Zyoud SH, Shakhshir M, Koni A, Abushanab AS, Shahwan M, Jairoun AA, et al. Mapping the global research landscape on insulin resistance: visualization and bibliometric analysis. World J Diabetes. 2022;13(9):786–98.

Chen JW, Guan Y, Zheng YL, Zhu K. Research trends and frontiers in exercise for movement disorders: a bibliometric analysis of global research from 2010 to 2021. Front Aging Neurosci. 2022;14: 977100.

Yu HY, Chang YC. A bibliometric analysis of platelet-rich fibrin in dentistry. Int J Environ Res Public Health. 2022;19(19):12545.

Zhang N, Li C, Chen J, Liu X, Wang Z, Ni J. Research hotspots and frontiers about role of visual perception in stroke: a bibliometric study. Front Neurol. 2022;13: 958875.

Li J, Chen C. Citespace: scientific text mining and visualization. China: Capital University of Economics and Business Press; Beijing; 2016. p. 117–9.

Shi Y, Wei W, Li L, Wei Q, Jiang F, Xia G, et al. The global status of research in breast cancer liver metastasis: a bibliometric and visualized analysis. Bioengineered. 2021;12(2):12246–62.

Kassander P. Asymptomatic gastric retention in diabetics (gastroparesis diabeticorum). Ann Intern Med. 1958;48(4):797–812.

Parkman HP, Van Natta ML, Abell TL, McCallum RW, Sarosiek I, Nguyen L, et al. Effect of nortriptyline on symptoms of idiopathic gastroparesis: the NORIG randomized clinical trial. JAMA. 2013;310(24):2640–9.

Pasricha PJ, Yates KP, Sarosiek I, McCallum RW, Abell TL, Koch KL, et al. Aprepitant has mixed effects on nausea and reduces other symptoms in patients with gastroparesis and related disorders. Gastroenterology. 2018;154(1):65-76.e11.

Hasler WL, Parkman HP, Wilson LA, Pasricha PJ, Koch KL, Abell TL, et al. Psychological dysfunction is associated with symptom severity but not disease etiology or degree of gastric retention in patients with gastroparesis. Am J Gastroenterol. 2010;105(11):2357–67.

Parkman HP, Wilson LA, Farrugia G, Koch KL, Hasler WL, Nguyen LA, et al. Delayed gastric emptying associates with diabetic complications in diabetic patients with symptoms of gastroparesis. Am J Gastroenterol. 2019;114(11):1778–94.

Wu H, Cheng K, Guo Q, Yang W, Tong L, Wang Y, et al. Mapping knowledge structure and themes trends of osteoporosis in rheumatoid arthritis: a bibliometric analysis. Front Med (Lausanne). 2021;23(8): 787228.

Yu X, Yu C, He W. Emerging trends and hot spots of NLRP3 inflammasome in neurological diseases: a bibliometric analysis. Front Pharmacol. 2022;13: 952211.

Janssens J, Peeters TL, Vantrappen G, Tack J, Urbain JL, De Roo M, et al. Improvement of gastric emptying in diabetic gastroparesis by erythromycin. Preliminary studies. N Engl J Med. 1990;322(15):1028–31.

Jung HK, Choung RS, Locke GR 3rd, Schleck CD, Zinsmeister AR, Szarka LA, et al. The incidence, prevalence, and outcomes of patients with gastroparesis in Olmsted County, Minnesota, from 1996 to 2006. Gastroenterology. 2009;136(4):1225–33.

Abell T, McCallum R, Hocking M, Koch K, Abrahamsson H, Leblanc I, et al. Gastric electrical stimulation for medically refractory gastroparesis. Gastroenterology. 2003;125(2):421–8.

McCallum RW, Chen JD, Lin Z, Schirmer BD, Williams RD, Ross RA. Gastric pacing improves emptying and symptoms in patients with gastroparesis. Gastroenterology. 1998;114(3):456–61.

Gao M, Zhang H, Gao Z, Sun Y, Wang J, Wei F, et al. Global hotspots and prospects of perimenopausal depression: a bibliometric analysis via CiteSpace. Front Psychiatry. 2022;13: 968629.

Long D, Mao C, Zhang X, Liu Y, Shangguan X, Zou M, et al. Coronary heart disease and gut microbiota: a bibliometric and visual analysis from 2002 to 2022. Front Cardiovasc Med. 2022;9: 949859.

Sachdeva P, Kantor S, Knight LC, Maurer AH, Fisher RS, Parkman HP. Use of a high caloric liquid meal as an alternative to a solid meal for gastric emptying scintigraphy. Dig Dis Sci. 2013;58(7):2001–6.

Pasricha PJ, Camilleri M, Hasler WL, Parkman HP. White paper AGA: gastroparesis: clinical and regulatory insights for clinical trials. Clin Gastroenterol Hepatol. 2017;15(8):1184–90.

Revicki DA, Rentz AM, Dubois D, Kahrilas P, Stanghellini V, Talley NJ, et al. Development and validation of a patient-assessed gastroparesis symptom severity measure: the gastroparesis cardinal symptom index. Aliment Pharmacol Ther. 2003;18(1):141–50.

Hasler WL. Gastroparesis: pathogenesis, diagnosis and management. Nat Rev Gastroenterol Hepatol. 2011;8(8):438–53.

Radetic M, Kamal A, Rouphael C, Kou L, Lyu R, Cline M. Severe gastroparesis is associated with an increased incidence of slow-transit constipation as measured by wireless motility capsule. Neurogastroenterol Motil. 2021;33(5): e14045.

Griffith GH, Owen GM, Kirkman S, Shields R. Measurement of rate of gastric emptying using chromium-51. Lancet. 1966;1(7449):1244–5.

Camilleri M, Hasler WL, Parkman HP, Quigley EM, Soffer E. Measurement of gastrointestinal motility in the GI laboratory. Gastroenterology. 1998;115(3):747–62.

Donohoe KJ, Maurer AH, Ziessman HA, Urbain JL, Royal HD, Martin-Comin J, et al. Procedure guideline for adult solid-meal gastric-emptying study 3.0. J Nucl Med Technol. 2009;37(3):196–200.

Parkman HP. Scintigraphy for evaluation of patients for GI motility disorders—the referring physician’s perspective. Semin Nucl Med. 2012;42(2):76–8.

Abell TL, Camilleri M, Donohoe K, Hasler WL, Lin HC, Maurer AH, et al. Consensus recommendations for gastric emptying scintigraphy: a joint report of the American Neurogastroenterology and Motility Society and the Society of Nuclear Medicine. Am J Gastroenterol. 2008;103(3):753–63.

Wise JL, Vazquez-Roque MI, McKinney CJ, Zickella MA, Crowell MD, Lacy BE. Gastric emptying scans: poor adherence to national guidelines. Dig Dis Sci. 2021;66(9):2897–906.

Camilleri M, Shin A. Novel and validated approaches for gastric emptying scintigraphy in patients with suspected gastroparesis. Dig Dis Sci. 2013;58(7):1813–5.

Ziessman HA, Chander A, Clarke JO, Ramos A, Wahl RL. The added diagnostic value of liquid gastric emptying compared with solid emptying alone. J Nucl Med. 2009;50(5):726–31.

Bharucha AE, Kudva YC, Prichard DO. Diabetic gastroparesis. Endocr Rev. 2019;40(5):1318–52.

Mekaroonkamol P, Tiankanon K, Rerknimitr R. A new paradigm shift in gastroparesis management. Gut Liver. 2022;16(6):825–39.

Usai-Satta P, Bellini M, Morelli O, Geri F, Lai M, Bassotti G. Gastroparesis: new insights into an old disease. World J Gastroenterol. 2020;26(19):2333–48.

Szarka LA, Camilleri M, Vella A, Burton D, Baxter K, Simonson J, et al. A stable isotope breath test with a standard meal for abnormal gastric emptying of solids in the clinic and in research. Clin Gastroenterol Hepatol. 2008;6(6):635-643.e1.

Ghoos YF, Maes BD, Geypens BJ, Mys G, Hiele MI, Rutgeerts PJ, et al. Measurement of gastric emptying rate of solids by means of a carbon-labeled octanoic acid breath test. Gastroenterology. 1993;104(6):1640–7.

Grover M, Farrugia G, Stanghellini V. Gastroparesis: a turning point in understanding and treatment. Gut. 2019;68(12):2238–50.

George NS, Sankineni A, Parkman HP. Small intestinal bacterial overgrowth in gastroparesis. Dig Dis Sci. 2014;59(3):645–52.

Tran K, Brun R, Kuo B. Evaluation of regional and whole gut motility using the wireless motility capsule: relevance in clinical practice. Ther Adv Gastroenterol. 2012;5(4):249–60.

Sangnes DA, Søfteland E, Bekkelund M, Frey J, Biermann M, Gilja OH, et al. Wireless motility capsule compared with scintigraphy in the assessment of diabetic gastroparesis. Neurogastroenterol Motil. 2020;32(4): e13771.

Lee AA, Rao S, Nguyen LA, Moshiree B, Sarosiek I, Schulman MI, et al. Validation of diagnostic and performance characteristics of the wireless motility capsule in patients with suspected gastroparesis. Clin Gastroenterol Hepatol. 2019;17(9):1770-1779.e2.

Ingrosso MR, Camilleri M, Tack J, Ianiro G, Black CJ, Ford AC. Efficacy and safety of drugs for gastroparesis: systematic review and network meta-analysis. Gastroenterology. 2023;164(4):642–54.

Camilleri M. Beyond metoclopramide for gastroparesis. Clin Gastroenterol Hepatol. 2022;20(1):19–24.

Hejazi RA, McCallum RW. Diabetic gastroparesis: a review of medical treatments. Prac Gastroenterol. 2009;24:10–20.

Parkman HP, Carlson MR, Gonyer D. Metoclopramide nasal spray is effective in symptoms of gastroparesis in diabetics compared to conventional oral tablet. Neurogastroenterol Motil. 2014;26(4):521–8.

McCallum RW, Ricci DA, Rakatansky H, Behar J, Rhodes JB, Salen G, et al. A multicenter placebo-controlled clinical trial of oral metoclopramide in diabetic gastroparesis. Diabetes Care. 1983;6(5):463–7.

Ricci DA, Saltzman MB, Meyer C, Callachan C, McCallum RW. Effect of metoclopramide in diabetic gastroparesis. J Clin Gastroenterol. 1985;7(1):25–32.

Parkman HP, Carlson MR, Gonyer D. Metoclopramide nasal spray reduces symptoms of gastroparesis in women, but not men, with diabetes: results of a phase 2B randomized study. Clin Gastroenterol Hepatol. 2015;13(7):1256-1263.e1.

Lai CH, Yeh YC, Chen YY. Metoclopramide as a prokinetic agent for diabetic gastroparesis: revisiting the risk of parkinsonism. Ther Adv Drug Saf. 2019;10:2042098619854007.

American Diabetes Association. 7. Approaches to glycemic treatment. Diabetes Care. 2016;39(Suppl 1):S52–9.

Heckert J, Parkman HP. Therapeutic response to domperidone in gastroparesis: a prospective study using the GCSI-daily diary. Neurogastroenterol Motil. 2018;30(1):e13246. https://doi.org/10.1111/nmo.13246 .

Mansi C, Savarino V, Vigneri S, Perilli D, Melga P, Sciabà L, et al. Gastrokinetic effects of levosulpiride in dyspeptic patients with diabetic gastroparesis. Am J Gastroenterol. 1995;90(11):1989–93.

Manabe N, Wong BS, Camilleri M. New-generation 5-HT4 receptor agonists: potential for treatment of gastrointestinal motility disorders. Expert Opin Investig Drugs. 2010;19(6):765–75.

De Maeyer JH, Lefebvre RA, Schuurkes JA. 5-HT4 receptor agonists: similar but not the same. Neurogastroenterol Motil. 2008;20(2):99–112.

Cutts TF, Luo J, Starkebaum W, Rashed H, Abell TL. Is gastric electrical stimulation superior to standard pharmacologic therapy in improving GI symptoms, healthcare resources, and long-term health care benefits? Neurogastroenterol Motil. 2005;17(1):35–43.

Andrews CN, Woo M, Buresi M, Curley M, Gupta M, Tack J, et al. Prucalopride in diabetic and connective tissue disease-related gastroparesis: randomized placebo-controlled crossover pilot trial. Neurogastroenterol Motil. 2021;33(1): e13958.

Carbone F, Van den Houte K, Clevers E, Andrews CN, Papathanasopoulos A, Holvoet L, et al. Prucalopride in gastroparesis: a randomized placebo-controlled crossover study. Am J Gastroenterol. 2019;114(8):1265–74.

Fahler J, Wall GC, Leman BI. Gastroparesis-associated refractory nausea treated with aprepitant. Ann Pharmacother. 2012;46(12): e38.

Chong K, Dhatariya K. A case of severe, refractory diabetic gastroparesis managed by prolonged use of aprepitant. Nat Rev Endocrinol. 2009;5(5):285–8.

Pasricha PJ, Yates KP, Nguyen L, Clarke J, Abell TL, Farrugia G, et al. Outcomes and factors associated with reduced symptoms in patients with gastroparesis. Gastroenterology. 2015;149(7):1762-1774.e4.

Bortolotti M. Gastric electrical stimulation for gastroparesis: a goal greatly pursued, but not yet attained. World J Gastroenterol. 2011;17(3):273–82.

Saleem S, Hussain A, Alsamman MA, Inayat F, Kaler J, Tansel A, et al. Characteristics of patients who underwent gastric electrical stimulation vs surgical pyloric interventions for refractory gastroparesis. Saudi J Gastroenterol. 2021;27(5):309–15.

Bilgutay AM, Wingrove R, Griffen WO, Bonnabeau RC Jr, Liliehei CW. Gastro-intestinal pacing: a new concept in the treatment of ileus. Ann Surg. 1963;158(3):338–48.

Sarna SK. Gastrointestinal electrical activity: terminology. Gastroenterology. 1975;68(6):1631–5.

Sarna SK, Bowes KL, Daniel EE. Gastric pacemakers. Gastroenterology. 1976;70(2):226–31.

Soffer EE. Gastric electrical stimulation for gastroparesis. J Neurogastroenterol Motil. 2012;18(2):131–7.

Ward MP, Gupta A, Wo JM, Rajwa B, Furness JB, Powley TL, et al. An emerging method to noninvasively measure and identify vagal response markers to enable bioelectronic control of gastroparesis symptoms with gastric electrical stimulation. J Neurosci Methods. 2020;336: 108631.

Forster J, Sarosiek I, Delcore R, Lin Z, Raju GS, McCallum RW. Gastric pacing is a new surgical treatment for gastroparesis. Am J Surg. 2001;182(6):676–81.

Saleem S, Aziz M, Khan AA, Williams MJ, Mathur P, Tansel A, et al. Gastric electrical stimulation for the treatment of gastroparesis or gastroparesis-like symptoms: a systemic review and meta-analysis. Neuromodulation. 2022;S1094–7159(22):01338–41.

McCallum RW, Lin Z, Forster J, Roeser K, Hou Q, Sarosiek I. Gastric electrical stimulation improves outcomes of patients with gastroparesis for up to 10 years. Clin Gastroenterol Hepatol. 2011;9(4):314-319.e1.

McCallum RW, Dusing RW, Sarosiek I, Cocjin J, Forster J, Lin Z. Mechanisms of symptomatic improvement after gastric electrical stimulation in gastroparetic patients. Neurogastroenterol Motil. 2010;22(2):161–7, e50-1.

Jayanthi NV, Dexter SP, Sarela AI; Leeds Gastroparesis Multi-Disciplinary Team. Gastric electrical stimulation for treatment of clinically severe gastroparesis. J Minim Access Surg. 2013;9(4):163–7.

Inoue H, Minami H, Kobayashi Y, Sato Y, Kaga M, Suzuki M, et al. Peroral endoscopic myotomy (POEM) for esophageal achalasia. Endoscopy. 2010;42(4):265–71.

Khashab MA, Stein E, Clarke JO, Saxena P, Kumbhari V, Chander Roland B, et al. Gastric peroral endoscopic myotomy for refractory gastroparesis: first human endoscopic pyloromyotomy (with video). Gastrointest Endosc. 2013;78(5):764–8.

Malik Z, Sankineni A, Parkman HP. Assessing pyloric sphincter pathophysiology using EndoFLIP in patients with gastroparesis. Neurogastroenterol Motil. 2015;27(4):524–31.

Mohan BP, Chandan S, Jha LK, Khan SR, Kotagiri R, Kassab LL, et al. Clinical efficacy of gastric per-oral endoscopic myotomy (G-POEM) in the treatment of refractory gastroparesis and predictors of outcomes: a systematic review and meta-analysis using surgical pyloroplasty as a comparator group. Surg Endosc. 2020;34(8):3352–67.

Yan J, Tan Y, Zhou B, Zhang S, Wang X, Liu D. Gastric per-oral endoscopic myotomy (G-POEM) is a promising treatment for refractory gastroparesis: a systematic review and meta-analysis. Rev Esp Enferm Dig. 2020;112(3):219–28.

Zhang H, Zhang J, Jiang A, Ni H. Gastric peroral endoscopic myotomy for gastroparesis: a systematic review of efficacy and safety. Gastroenterol Hepatol. 2019;42(7):413–22.

Aziz M, Gangwani MK, Haghbin H, Dahiya DS, Sohail AH, Kamal F, et al. Gastric peroral endoscopic myotomy versus surgical pyloromyotomy/pyloroplasty for refractory gastroparesis: systematic review and meta-analysis. Endosc Int Open. 2023;11(4):E322–9.

Montecucco C, Molgó J. Botulinal neurotoxins: revival of an old killer. Curr Opin Pharmacol. 2005;5(3):274–9.

Watkins CC, Sawa A, Jaffrey S, Blackshaw S, Barrow RK, Snyder SH, et al. Insulin restores neuronal nitric oxide synthase expression and unction that is lost in diabetic gastropathy. J Clin Invest. 2000;106:803.

Reddymasu SC, Singh S, Sankula R, Lavenbarg TA, Olyaee M, McCallum RW. Endoscopic pyloric injection of botulinum toxin-a for the treatment of postvagotomy gastroparesis. Am J Med Sci. 2009;337(3):161–4.

Mearin F, Camilleri M, Malagelada JR. Pyloric dysfunction in diabetics with recurrent nausea and vomiting. Gastroenterology. 1986;90(6):1919–25.

Ezzeddine D, Jit R, Katz N, Gopalswamy N, Bhutani MS. Pyloric injection of botulinum toxin for treatment of diabetic gastroparesis. Gastrointest Endosc. 2002;55(7):920–3.

Coleski R, Anderson MA, Hasler WL. Factors associated with symptom response to pyloric injection of botulinum toxin in a large series of gastroparesis patients. Dig Dis Sci. 2009;54(12):2634–42.

Bai Y, Xu MJ, Yang X, Xu C, Gao J, Zou DW, et al. A systematic review on intrapyloric botulinum toxin injection for gastroparesis. Digestion. 2010;81(1):27–34.

Sperber AD, Bangdiwala SI, Drossman DA, Ghoshal UC, Simren M, Tack J, et al. Worldwide prevalence and burden of functional gastrointestinal disorders, results of Rome Foundation Global Study. Gastroenterology. 2021;160(1):99-114.e3.

Download references

Acknowledgements

The authors appreciate the publications included in this study.

Funding was provided by the National Natural Science Foundation of China, Grant/Award Number: 82174352. Capital Health Research and Development of Special Fund, Grant/Award Number: 2020-2-4152.

Author information

Meng Li and Ning Gao contributed equally to this work.

Authors and Affiliations

Department of Gastroenterology, Guang’anmen Hospital, China Academy of Chinese Medical Sciences, No. 5 Beixiange St., Xicheng District, Beijing, 100053, China

Meng Li, Shaoli Wang & Zhen Liu

Department of Acupuncture and Moxibustion, Guang’anmen Hospital, China Academy of Chinese Medical Sciences, No. 5 Beixiange St., Xicheng District, Beijing, 100053, China

Ning Gao & Yufeng Guo

You can also search for this author in PubMed   Google Scholar

Contributions

YFG and ZL contributed to the conception and design of the study. SLW is responsible for literature searching and data collection. ML is responsible for statistical analysis and charting. This manuscript was drafted by ML and revised by NG. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Yufeng Guo or Zhen Liu .

Ethics declarations

Ethics approval and consent to participate.

The data for this study were downloaded directly from the database and not applicable for ethical approval.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Cite this article.

Li, M., Gao, N., Wang, S. et al. A global bibliometric and visualized analysis of the status and trends of gastroparesis research. Eur J Med Res 28 , 543 (2023). https://doi.org/10.1186/s40001-023-01537-1

Download citation

Received : 26 November 2022

Accepted : 17 November 2023

Published : 28 November 2023

DOI : https://doi.org/10.1186/s40001-023-01537-1

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Gastroparesis
• Bibliometric
• Research hotspots

European Journal of Medical Research

ISSN: 2047-783X

• Submission enquiries: [email protected]
• General enquiries: [email protected]

Cookies on GOV.UK

We use some essential cookies to make this website work.

We’d like to set additional cookies to understand how you use GOV.UK, remember your settings and improve government services.

We also use cookies set by other sites to help us deliver content from their services.

You have accepted additional cookies. You can change your cookie settings at any time.

You have rejected additional cookies. You can change your cookie settings at any time.

• Government efficiency, transparency and accountability
• Government spending
• Autumn Statement 2023
• HM Treasury

Autumn Statement 2023 (HTML)

Updated 28 November 2023

© Crown copyright 2023

This publication is licensed under the terms of the Open Government Licence v3.0 except where otherwise stated. To view this licence, visit nationalarchives.gov.uk/doc/open-government-licence/version/3 or write to the Information Policy Team, The National Archives, Kew, London TW9 4DU, or email: [email protected] .

Where we have identified any third party copyright information you will need to obtain permission from the copyright holders concerned.

This publication is available at https://www.gov.uk/government/publications/autumn-statement-2023/autumn-statement-2023-html

• Presented to Parliament by the Chancellor of the Exchequer by Command of His Majesty
• November 2023
• CP number 977
• © Crown Copyright 2023
• ISBN 978-1-5286-4572-0

Executive Summary

In January 2023 the Prime Minister set out three economic priorities: to halve inflation, grow the economy and reduce debt. Consumer Prices Index (CPI) inflation has now more than halved from a peak of over 11% last autumn to 4.6% in October 2023. The economy has recovered from the pandemic more quickly than first thought, grown more than expected this year, and is forecast to grow in every year of the forecast period. Underlying debt is forecast to fall as a proportion of GDP from 2027-28 and the government has greater headroom against its fiscal rules than at Spring Budget 2023.

The government must continue to bear down on inflation, and the Office for Budget Responsibility (OBR) forecasts that government policies in the Autumn Statement will reduce inflation next year. With inflation falling and the economy and public finances stabilised after a series of unprecedented shocks, the government can now take the long-term decisions necessary to strengthen the economy and build a brighter future.

The government is focusing on five areas: reducing debt; cutting tax and rewarding hard work; backing British business; building domestic and sustainable energy; and delivering world-class education. The Autumn Statement takes a responsible approach to public spending to keep debt falling, cuts taxes for working people and businesses, reforms welfare to help people into work and removes barriers to business investment to boost growth.

The OBR estimates that government decisions at the Autumn Statement will boost business investment by £14 billion and bring a further 78,000 people into employment by the end of the forecast period. This means that the combined impacts of the Spring and Autumn policy measures will increase the number of people in work by around 200,000 by the end of the forecast.

Together, Autumn Statement policies are forecast to increase the economy’s potential output in the medium term by 0.3%. This is in addition to a 0.2% increase to potential GDP resulting from announcements at Spring Budget 2023. These are the two largest increases to labour supply and potential GDP resulting from fiscal policy the OBR has ever scored in a medium-term forecast.

Reducing debt

Reducing debt and borrowing is essential to controlling inflation, keeping mortgage rates affordable and funding public services sustainably. After accounting for decisions at the Autumn Statement, borrowing is forecast to be lower this year, next year and on average over the forecast period compared to the OBR’s March forecast. Underlying debt is also lower as a percentage of GDP, by an average of 2.1 percentage points across the forecast.

The government is on track to meet its debt and borrowing fiscal rules with greater headroom against both rules compared to spring. Underlying debt begins to fall from 2027-28 and then falls to 92.8% of GDP in the target year (2028-29). The debt rule is met with £13 billion headroom, double the £6.5 billion held in spring. The borrowing rule is met three years ahead of target and with £61.5 billion headroom, an increase of £22.3 billion since the spring.

The government has taken difficult but necessary decisions to get debt falling and ensure our public services continue to operate effectively in the face of financial and operational pressures. The Autumn Statement reaffirms the commitments made at Autumn Statement 2022 to make available up to £14.1 billion for the NHS and adult social care and provide an additional £2 billion for schools in both 2023‑24 and 2024-25. Total departmental spending will be £85 billion higher in real terms by 2028-29 than at the start of this Parliament (2019-20). As a proportion of income, households on the lowest incomes have benefited the most from government decisions on tax, welfare and public spending since Autumn Statement 2022.

Tackling waste and inefficiency has always been at the heart of the government’s approach to public spending, but high inflation continues to put additional pressure on departmental budgets. The government has therefore driven even greater efficiencies than those assumed at Spending Review 2021 to manage down these pressures and ensure departments can live within their settlements and deliver the service outcomes the public expect.

The government continues to tackle tax non-compliance and is introducing the largest package of measures since 2016. This is forecast to raise an additional £5 billion of tax revenue over the next five years, which would otherwise have gone unpaid, to fund vital public services.

While day-to-day spending will continue to grow above inflation in future years, public spending faces many pressures. The government must get the most out of every pound of taxpayers‘ money by boosting productivity and focusing spending on the government’s priorities. The government continues to drive forward the Public Sector Productivity Programme to reimagine the way public services are delivered.

Cutting tax and rewarding hard work

The government has had to take difficult decisions to restore the stability of the public finances in wake of the economic shocks caused by the COVID-19 pandemic and Putin’s illegal invasion of Ukraine. But with inflation falling, growth more resilient than expected this year and debt forecast to reduce, the government can now return some of that money to taxpayers and ensure people keep more of what they earn.

The government is cutting taxes for over 29 million working people. The main rate of Class 1 employee National Insurance contributions (NICs) will be cut from 12% to 10% from 6 January 2024, with employees benefitting from January onwards. This means the average worker on £35,400 will receive a tax cut in 2024-25 of over £450. This will reward work and sustainably grow the economy, providing a combined rate of income tax and NICs for an employee paying the basic rate of tax of 30% – the lowest since the 1980s.

The government is also cutting taxes for the self-employed from 6 April 2024. The government is reducing the main rate of Class 4 self-employed NICs from 9% to 8%, and will abolish the outdated and needlessly complex Class 2 self-employed NICs, reforming and simplifying the tax system. Taken together these changes will benefit around 2 million self-employed individuals and result in an average self-employed person on £28,200 saving £350 in 2024-25. 

These tax cuts are part of the government’s long-term strategy for growing the economy and getting more people into work, ensuring that the UK has the labour market it needs for its future. The OBR forecast these changes will increase the number of people in employment by 28,000 by 2028-29, alongside a further substantial economic benefit from those in work increasing their hours.

The government is delivering on its commitment to end hourly low pay. From 1 April 2024, the National Living Wage (NLW) will increase by 9.8% to £11.44 with the age threshold lowered from 23 to 21 years old. This represents an increase of over £1,800 to the annual earnings of a full-time worker on the NLW and is expected to benefit over 2.7 million low paid workers.

The government is reforming the welfare system so it better supports people into work where they are able, focusing on the long-term sick and disabled, and long-term unemployed. The government’s Back to Work Plan, supported by over £2.5 billion in funding over the next five years, is an ambitious new programme to help people look for and stay in work, manage their health conditions, and stem the flow into sickness related inactivity.

There are now a record 2.6 million people who are economically inactive due to long-term sickness and disability, almost half a million more than before the pandemic. The government is taking steps to reform the fit note process to support more people to resume work after a period of illness and expanding the Universal Support programme that matches those with health conditions and disabilities into vacancies. The government is also expanding the NHS Talking Therapies programme and Individual Placement and Support to help people with mental health conditions. The government will work with employers and business representatives to develop and promote best employment practices to support employees with health and disability issues.

The government is reforming the Work Capability Assessment (WCA) so that more individuals, such as those with limited mobility and mental health conditions, receive the right support to find work where they can, rather than being automatically deemed unable to work or look for work.

To better help the long-term unemployed into work, the government is expanding Additional Jobcentre Support, extending and expanding the Restart programme in England and Wales, and strengthening sanctions for those who choose not to engage with measures that help them find work.

For those that cannot work for legitimate reasons there must always be a safety net. The government will uprate all working age benefits for 2024-25 in full, by September 2023 CPI inflation of 6.7%, and will continue to protect pensioner incomes by maintaining the Triple Lock and uprating the basic State Pension, new State Pension and Pension Credit standard minimum guarantee for 2024-25 in line with average earnings growth of 8.5%.

In response to the energy crisis, the government provided one of the largest support packages in Europe. To further support low-income households with increasing rent costs, the government will raise Local Housing Allowance rates to the 30th percentile of local market rents in April 2024. This will benefit 1.6 million low-income households, who will be around £800 a year better off on average in 2024-25. Taken together, support to households to help with the high cost of living is worth £104 billion over 2022-23 to 2024-25, or £3,700 per household on average.

Backing British business

When the economy is growing there are more jobs, higher wages and increasing living standards. Since 2010 the UK economy has grown the third fastest in the G7, faster than France, Germany, Japan and Italy. Unprecedented shocks have hit the economy since 2020, but with stability restored, the government is backing British business to drive long-term economic growth.

The government believes the best way to grow the economy is not through higher borrowing and untargeted support but by creating the conditions for the private sector to thrive by removing barriers to investment and cutting taxes for businesses.

Business investment in the UK has been lower than other leading advanced economies at 9.5% of nominal GDP over the last 10 years, compared to 11.2% on average in France, Germany and the US. Addressing this gap is crucial to improving UK productivity and so the government is introducing an ambitious package of measures to unlock business investment.

The UK already has one of the most competitive business tax regimes of any major economy, with the lowest headline rate of corporation tax in the G7. In 2021, the government introduced the super deduction to incentivise business investment. Since then, investment growth has been faster in the UK than any other country in the G7. At Spring Budget 2023 the government went further, replacing this with full expensing for three years from 1 April 2023, allowing businesses to write off the full cost of qualifying plant and machinery investment.

The government is now making this change permanent. Worth over £10 billion a year, full expensing is the biggest business tax cut in modern British history. This makes the UK’s capital allowances regime one of the most generous in the world, and the OBR expect this will unlock an additional £14 billion of investment over the forecast period. This will improve the UK’s capital stock, help close the productivity gap and drive sustainable growth. The government is also making changes worth £280 million a year to simplify and improve R&D tax reliefs, helping to drive innovation in the UK.

The government is removing barriers to investment in critical infrastructure by reforming the planning system to speed up approvals and setting out a plan to reduce the time it takes for new projects to connect to the grid. Together these reforms will unlock new commercial developments that will enhance our energy security and help drive the transition to net zero.

The government is announcing a business rates support package worth £4.3 billion over the next five years to support small businesses and the high street. The small business multiplier will be frozen for a fourth consecutive year, and Retail, Hospitality and Leisure (RHL) relief will be extended, ensuring the most vulnerable businesses continue to be supported. The standard rate multiplier will be uprated in line with CPI inflation. While this will increase business rates bills for some, large retailers are expected to benefit from hundreds of millions of pounds of tax relief per year as a result of full expensing.

Businesses need access to capital to grow and invest in the UK. The Autumn Statement builds on the Chancellor’s Mansion House speech with a package of measures to reform the pensions market to unlock investment into high growth sectors and generate increased returns for savers.

The government continues to back the growth sectors of the future and is announcing further targeted support for digital technology, green industries, life sciences, advanced manufacturing and creative industries. This includes making available £4.5 billion to unlock investment in strategic manufacturing sectors – auto, aerospace, life sciences and clean energy – which are developing cutting edge technology and driving our transition to net zero. Together with existing manufacturing support and decarbonisation plans, this funding will level up communities across the country with higher-paid jobs, improve the UK’s energy security, and help grow the sectors of the future.

The government is delivering on levelling up and announcing further measures to support growth and investment across the UK, including confirming the next set of investment zones in Greater Manchester, the West Midlands, and the East Midlands; and doubling the flexible funding envelope for each investment zone from £80 million to £160 million by extending the programme and associated tax reliefs from five to ten years.

Together with submitted plans for investment in regulated utilities, the Autumn Statement measures could raise business investment by around £20 billion per year in a decade’s time.

The long-term decisions taken at the Autumn Statement keep debt falling, cut taxes and reform welfare to reward hard work, and unlock billions of pounds of business investment to drive sustainable growth.

Economic and Fiscal Outlook

In January 2023 the Prime Minister set out three economic priorities: to halve inflation, grow the economy and reduce debt. The latest Office for National Statistics (ONS) data and forecasts from the Office for Budget Responsibility (OBR) show: [footnote 1]

• Inflation is less than half its peak. Responsible decisions taken by the government to limit borrowing have supported the Bank of England in its action to bring inflation down; [footnote 2]
• Economic growth has been resilient, and the economy is now expected to grow in every year of the forecast period. Revisions to gross domestic product (GDP) show that the UK economy recovered more strongly from the pandemic than previously thought;
• Debt is forecast to fall as a proportion of GDP over the medium term, with greater headroom than at Spring Budget 2023.

The government must continue to bear down on inflation, and the OBR forecasts that government policies in the Autumn Statement will reduce inflation next year. With inflation falling and the economy and public finances stabilised after a series of unprecedented shocks, the government can now take the long‑term decisions necessary to strengthen the economy and build a brighter future.

The government is focusing on five areas: reducing debt; cutting tax and rewarding hard work; backing British business; building domestic and sustainable energy; and delivering world class education. The Autumn Statement takes a responsible approach to spending to keep debt falling, cuts taxes for working people and businesses, reforms welfare to help people into work and removes barriers to business investment to boost growth.

The OBR has revised up its forecast for growth this year, and the economy is now expected to grow in every year of the forecast period. The OBR estimates that government decisions at the Autumn Statement will boost business investment by £14 billion and bring a further 78,000 people into the labour market by the end of the forecast period. Together, these measures increase the economy’s potential output in the medium term by 0.3%. This means that the policy measures announced at Spring Budget 2023 and this Autumn Statement have been assessed by the OBR as increasing potential output by a combined 0.5%, resulting in the two largest increases in potential GDP since it was established.

The OBR’s forecast shows that, compared to Spring Budget 2023, borrowing is lower this year and next, as well as on average across the forecast, and debt as a proportion of GDP is lower in every year. The government has met its borrowing and debt rules with improved headroom in the fifth year of the forecast. Given the stronger fiscal outlook, responsible policy choices at Autumn Statement support lower taxes and long-term, sustainable growth.

A resilient economy and public finances

Growth has been resilient this year.

GDP growth has been more resilient than forecast in the spring. Output grew by a cumulative 0.5% during the first three quarters of 2023. This compares to the OBR’s March forecast for a contraction and was faster than Germany, Italy and the euro area as a whole. Revisions to the National Accounts, explained in Box 1.A, mean that the level of GDP is higher than previously thought. GDP growth has slowed into the second half of 2023 as higher interest rates contributed to a fall in household consumption.

Box 1.A Revisions to GDP

Estimates of GDP are revised as the ONS incorporates more data and improves its methods for measuring economic activity. The most recent revisions have been historically large due to more uncertainty than usual in estimates of GDP during the pandemic.

On 29 September 2023, the ONS published revisions which showed a shallower contraction in GDP in 2020 and a faster recovery in 2021. The level of real GDP was revised up by 2.0%. GDP recovered past its pre-pandemic peak earlier than previously thought. The revisions to real GDP were similarly reflected in higher estimates of nominal GDP. A larger nominal economy than previously estimated helps to explain why tax receipts have been stronger than forecast. Since the pandemic, the UK has recovered more rapidly than Germany and at a similar rate to France.

The revisions to components of GDP were also significant. Box 1.C in the Spring Budget noted public sector output accounted for much of the weakness relative to European peers with private sector output having been more comparable. [footnote 3] The latest data show that public sector output – in particular in the health sector – was much stronger than previously thought, outstripping growth in the private sector. Public sector productivity remains a challenge, lying below pre‑pandemic levels.

The revised data shows that business investment grew nearly twice as fast as previously thought since the pandemic. Business investment as a share of GDP remains relatively low compared to other major European economies. Household consumption was also higher than previously thought between mid 2021 and late 2022, driven by higher than previously estimated real incomes. The household saving ratio has also been revised down since 2021, suggesting consumers saved less to support consumption than previously estimated.

Chart 1.1: Revisions to Real GDP since the pandemic

1 First quarterly estimate, 11 August 2023.

Source: Office for National Statistics, HMT calculations.

Business investment and consumption drove growth in the first half of the year. Growth was broad based across categories of business investment. There are likely to have been some positive effects from measures announced at previous fiscal events, including the super-deduction and temporary full expensing, as expected by the OBR. Quarterly business investment data is volatile and recently has been affected by one-off factors, but remains 4% above its pre-pandemic level.

Aggregate real household disposable income (RHDI) has been more resilient than expected in the spring. High inflation remains a challenge for many households, and this pressure is not spread equally. The costs of high inflation have been offset by stronger-than-expected income growth, thanks in part to government support measures. Instead of falling by 3.5% between Q2 2022 and Q2 2023, as was forecast at Spring Budget 2023, aggregate real incomes rose by 2.7%, surpassing their pre-pandemic level. Rising RHDI meant consumption grew in the first half of 2023.

Inflation has fallen significantly but has been more persistent than expected

The rate of Consumer Prices Index (CPI) inflation has fallen since its peak last autumn of over 11%, and was 4.6% in October 2023. Lower wholesale energy prices have been the main driver of lower inflation, which have reduced the Ofgem price cap for household energy bills. Food and others goods inflation has also fallen, but services inflation remains elevated.

Elevated inflation is a challenge globally and it remains above central banks’ targets in many advanced economies. In the UK, inflation has been more persistent than the OBR forecast at Spring Budget 2023. The OBR has judged that high energy costs since Putin’s illegal invasion of Ukraine have had a more significant impact on inflation than it previously thought. [footnote 4] In addition, domestically driven inflation pressure has proved more significant, due to excess demand in the economy and as wage growth has been stronger than expected. High rates of wage growth have been an important factor in services inflation remaining elevated.

Indicators suggest that recruitment difficulties have eased since the spring. [footnote 5] Vacancies have fallen across almost all sectors of the economy, and the number of unemployed people per vacancy has risen. This loosening in the labour market is expected to lead to slower wage growth over time. Wage growth remains elevated, at 7.9% in Q3, and is above rates consistent with inflation falling to the 2% target. High nominal wage growth has boosted tax receipts.

Labour market data on employment, unemployment and inactivity are currently subject to significant uncertainty. Concerns about data quality – relating to falling response rates – have led to a temporary suspension of the publication of Labour Force Survey (LFS) statistics. The ONS has published alternative experimental estimates, drawing on information taken from outside the LFS. [footnote 6] These estimates indicate that unemployment has risen steadily since the spring to 4.2% in Q3, in line with the OBR’s March forecast. The population estimates which underpin the LFS do not account for demographic changes since mid 2021, and are based on a mid 2021 assumption about total population growth, both of which are affecting current estimates of employment. Other administrative data suggest stronger growth in employees in the last two years than the LFS – employee numbers grew by 1.6 million in the two years to Q2 2023 in real-time PAYE data, compared to 0.6 million in the LFS. The ONS has published a plan to address concerns around the LFS. [footnote 7]

The independent Monetary Policy Committee (MPC) of the Bank of England has responded to high inflation by tightening monetary policy, through raising Bank Rate to 5.25%, from 0.1% in December 2021. [footnote 8] Central banks around the world have also been raising benchmark interest rates. Since the beginning of 2022, the European Central Bank (ECB) has raised interest rates by 4.5 percentage points and the US Federal Reserve by 5.25 percentage points. [footnote 9] , [footnote 10] The global increase in interest rates, necessary to bring down inflation, has weighed on growth in the UK and other advanced economies. Government debt interest costs have also increased as a result.

The government is borrowing less this year than expected in the spring, resulting in lower levels of debt

ONS data shows the government has borrowed less so far this year than implied by the OBR’s March forecast. This mainly reflects stronger-than-expected tax receipts.

The lower level of borrowing, alongside higher-than-forecast nominal GDP, means that public sector net debt (PSND) as a percentage of GDP is lower than implied by the OBR’s March forecast. The OBR forecasts that at the end of 2023-24 PSND will be £2.7 trillion or 97.9% of GDP. Although this remains high by historical standards, the UK is not alone in having an elevated level of debt following recent shocks. As set out in Box 1.B, UK general government gross debt as a share of GDP was the second lowest in the G7 in 2022. [footnote 11]

Box 1.B International fiscal comparisons

The latest International Monetary Fund (IMF) Fiscal Monitor indicates that, in 2022, UK general government gross debt as a share of GDP was lower than all G7 peers other than Germany and the level of UK borrowing as a share of GDP was in line with G7 peers. [footnote 12]

Chart 1.2: General government gross debt of the G7 in 2022

Source: International Monetary Fund, Fiscal Monitor, October 2023.

The government’s priority to reduce debt is aligned with the approach of other advanced economies. Several countries have reaffirmed their commitments to medium-term fiscal sustainability. In Europe, Germany has reimposed its constitutional debt brake, which limits its core budget deficit to 0.35% of GDP, while France has set out commitments to get debt falling over the medium term. [footnote 13] , [footnote 14] The European Commission has consulted on changes to the Stability and Growth Pact, proposing to reintroduce updated debt and deficit rules that have been suspended since the COVID-19 pandemic. [footnote 15] Elsewhere, Canada and Australia have committed to reducing their debt-to-GDP ratios over the medium term. [footnote 16] , [footnote 17]

The IMF forecasts UK borrowing to remain in line with G7 peers and debt to maintain a strong relative position. The OBR’s forecast would put UK borrowing third lowest of G7 countries in 2028-29 (comparing to IMF forecasts for 2028).

Chart 1.3: General government net borrowing of the G7 in 2028

The Office for Budget Responsibility (OBR) forecasts borrowing for the UK in the financial year of 2028-29.

Source: Office for Budget Responsibility and International Monetary Fund, Fiscal Monitor, October 2023.

Long-term decisions for a brighter future

The government is growing the supply side of the economy.

Over the last few years, the economy has been buffeted by a series of shocks, including the pandemic and an energy crisis. In addition to supporting households, the government has responded by prioritising UK energy security, forging new trading relationships and controlling borrowing. Building on Spring Budget 2023, now inflation has halved and as the economy recovers, the government is using the underlying fiscal improvement to tackle long-term economic challenges. The government is prioritising action in five critical areas: reducing debt; cutting taxes and rewarding hard work; building domestic and sustainable energy; backing British business; and delivering world-class education.

UK productivity growth has been subdued in the public and private sectors. This suppresses living standards and makes it more difficult to deliver the funding needed for world-class public services. Weaker growth in business investment has been one of the reasons for slower productivity growth in the UK since the Global Financial Crisis. As shown in Chart 1.4, business investment as a share of GDP is relatively low in the UK compared to other major European economies. Increasing business investment will lead to more capital being available per worker, allowing workers to be more productive and increasing growth and real incomes. Removing barriers to investment in critical infrastructure is necessary to increase Britain’s energy security and support the transition to net zero.

The Autumn Statement aims to boost business investment by introducing measures such as making capital full expensing permanent. The OBR estimates this measure will lead to £14 billion extra business investment over the forecast horizon. The additional business investment increases the capital stock permanently by 0.2%, which in turn increases potential output by 0.1% in 2028‑29. The OBR notes that other measures in the Autumn Statement ‘could also boost business investment particularly over the longer-term’. By making full expensing permanent at the Autumn Statement, the government is recognising the higher short-term fiscal cost of this measure, but this cost will decline over time while the increase to business investment will increase GDP in the long term.

Chart 1.4: Business investment in selected advanced economies(1)

1 GDP and business investment are in current prices.

Source: Organisation for Economic Co-operation and Development and HMT calculations.

Growth depends on the number of workers in the economy, as well as productivity. Labour market participation has improved since the spring, but inactivity has continued to increase among some groups, including those who are inactive due to long-term sickness. Growing the labour supply by helping these people back into work will increase the potential output of the economy. The Autumn Statement builds on the landmark labour market package introduced in the Spring Budget by introducing the Back to Work Plan.

Alongside a welfare system that supports people to work, allowing people to keep as much of their hard-earned money as possible is a priority for this government. As part of the government’s long-term plan to grow the economy it will cut taxes for 29 million working people.

The OBR says these measures will bring 78,000 people into the labour market. Although it is not reflected in the forecast, due to uncertainty around the impacts, the OBR notes that ‘some measures could provide a further boost to labour supply’, such as proposed changes to fit notes.

The OBR confirms that policies announced at the Autumn Statement will increase economic growth. It estimates that the overall effect of these supply-side measures is to boost the size of the economy by 0.3% by the end of the forecast. The OBR’s forecast also reflects long-term demographic and technological changes. The OBR judges that as the population ages, individuals will work for fewer hours on average. Due to the higher proportion of intangible assets in the economy, it assumes capital is being retired at a faster rate than previously. These factors mean that, prior to the impact of policy measures, labour and capital are assumed to grow more slowly than before, which pulls down long-term growth. This further justifies the government’s continued focus on creating growth by boosting the supply side of the economy.

The economy is expected to grow by 0.6% in 2023 and 0.7% in 2024. Growth is then forecast to increase to 1.4% in 2025 and an average of 1.9% between 2026 and 2028 as inflation falls, helping real wages grow more quickly, and as the effect of past interest rate increases fades. The OBR forecasts unemployment to rise to 4.6% in the middle of 2025, as slower GDP growth and higher interest rates weigh on labour demand. Unemployment is then expected to fall back to its structural rate of 4.1% at the end of the forecast horizon.

Managing risks and increasing resilience

Prioritising sustainable growth, repairing the public finances, and an effective risk management framework mean that the government has been able to support the economy through the shocks faced in recent years. The government remains alive to external and domestic risks, including further escalation of Putin’s illegal war in Ukraine, and the conflict in Israel and Gaza. An escalation of that conflict involving the broader region that risks a reduction in energy exports from the Middle East would have material financial market and economic impacts.

The government’s approach to economic and fiscal risk management is at the forefront of international best practice. Alongside Autumn Statement, the government has published its response to the OBR’s Fiscal Risks and Sustainability report. [footnote 18] The response sets out the actions the government is taking to address risks to the public finances, including those examined by the OBR.

The Autumn Statement goes further in building the UK’s capabilities to assess and manage risk. The government will provide up to £10 million of funding over 2024‑25 and 2025‑26 to finance research on risks to the economy and public finances. This will include the understanding of risk impacts, their potential mitigations and response preparations. For the first time, the government has published a report assessing the risks from existing contingent liabilities, as set out in Box 1.C.

Box 1.C Managing risk on the government’s balance sheet

A key area of fiscal risk comes from obligations that the government enters into, such as insurance, provisions and guarantees, known as contingent liabilities. Alongside the Autumn Statement the government has published for the first time an estimate of its overall stock of these obligations and their expected cost, putting the UK at the forefront of international best practice on reporting the fiscal implications of these types of balance sheet intervention. [footnote 19]

This assessment from the Contingent Liability Central Capability (CLCC) - the government’s centre of excellence for the management of guarantees, insurance and contingent liabilities - means the government can now make better decisions about taking risks onto its balance sheet. That is because new risks can be assessed against the existing stock of contingent liabilities for the first time. The CLCC’s expertise, alongside HM Treasury’s robust framework for approving policies that create new liabilities, better equips the government to judge the benefits and risks it takes on, helping to ensure value for money for the taxpayer. To aid transparency, the government will continue to report on the new major contingent liabilities it takes on, as in Table 1.2.

As is already the case for major tax and spending decisions, the government intends to apply in future the principle that new major guarantee or insurance schemes, or major changes to the risk held in existing schemes, are announced at fiscal events, to support the management of these risks as a portfolio across government. The government will retain the flexibility to respond to events to support the economy, households and businesses at any point when needed. This will further support fully-informed decision making that involves new risks and improve the value for money achieved from these schemes.

Sound money

Responsible fiscal policy is supporting the bank of england in reducing inflation.

Compared to Spring Budget 2023, the OBR forecasts that borrowing is lower on average across the forecast and debt as a proportion of GDP is lower in every year. PSND excluding the Bank of England (underlying debt) peaks at 93.2% of GDP and falls from 2027-28 to 92.8% in the final year of the forecast (2028-29). Headline debt (PSND) as a proportion of GDP falls in every full year of the forecast and is 3.2 percentage points lower across the forecast on average. Before policy decisions at Autumn Statement 2022, the OBR forecast that headline debt would rise to 99.6% of GDP. [footnote 20] Headline debt is now forecast to be 5.5 percentage points lower as a proportion of GDP by the end of the forecast, reflecting a combination of policy and revisions to GDP.

Public sector net borrowing (PSNB) peaks at £123.9 billion (4.5% of GDP) in 2023-24 and then falls until it reaches £35.0 billion (1.1% of GDP) in the final year of the forecast. The current budget is in balance from 2027‑28, reaching a position where day-to-day spending is funded through tax revenues and the government is only borrowing for investment.

Chart 1.5: Public sector net borrowing

Source: Office for National Statistics and Office for Budget Responsibility.

Compared to the March forecast, the OBR forecasts borrowing will be lower in 2024-25 and across the forecast period on average. Underlying improvements to the fiscal outlook have been used to deliver lower taxes and long-term sustainable growth, without adding to borrowing.

Tax receipts have been revised up across the forecast across all the main taxes, reflecting the resilience of the economy and inflation which has driven higher nominal earnings and higher nominal consumption. This increase more than offsets higher spending on welfare and debt interest costs from higher-than-expected inflation and interest rates. The OBR forecasts that debt interest costs will reach £116.2 billion this year (2023-24); £22.2 billion higher than forecast in March. Compared to departmental budgets, debt interest costs for 2023-24 would be second only to the Department for Health and Social Care (Table 2.1), which illustrates the importance of delivering on the government’s commitment to reducing debt.

Table 1.1: Changes in borrowing since March 2023

By increasing employment and investment and increasing the size of the economy, policy has indirect benefits to the public finances. On average, the underlying forecast improvement since the OBR’s March forecast is greater than the combined direct and indirect effects of policy decisions, as shown in Table 1.1.

Reflecting the improvement in the fiscal outlook, the Net Financing Requirement for the Debt Management Office in 2023-24 has been revised down by £10.5 billion, to £232.3 billion compared to the April remit. This decrease is to be met through a reduction in gross gilt issuance this year of £0.5 billion; and a £10.0 billion reduction in the financing raised through Treasury bill issuance for debt management purposes. The government’s financing plans for 2023-24 are summarised in Annex A.

Alongside its focus on fiscal sustainability the government continues to support the MPC in its action to bring inflation down to the 2% target. The government has published the remit for the MPC alongside Autumn Statement, to reaffirm that the MPC’s target of price stability is defined as 2% CPI inflation, which applies at all times.

Responsible decisions on borrowing are a key pillar of government support to the MPC. As set out in Box 1.D, fiscal policy is aligned with monetary policy by withdrawing support at a pace well matched to the strength of the economy. Fiscal policy is adding less to demand than forecast in the spring, as demonstrated by the primary deficit (both adjusted and unadjusted for the economic cycle) being lower in every year of the forecast.

Box 1.D Fiscal stance

Fiscal policy affects growth, inflation and monetary policy because changes in spending and taxation add or withdraw demand to and from the economy. Measures of the level of that impact are called the ‘fiscal stance’; measures of changes in that impact are called the ‘fiscal impulse’.

Estimates of the fiscal stance are usually derived from headline borrowing. PSNB is currently elevated, but is due to fall to 1.1% of GDP in the final year of the forecast. When assessing the fiscal stance, net debt interest costs are often removed from borrowing, as interest payments are not a good measure of stimulus to the economy. In addition, cyclical changes in the economy are accounted for, because, for example, tax revenues will rise temporarily if the economy is running above capacity. These adjustments give the cyclically-adjusted primary deficit (CAPD), shown in Chart 1.6 alongside headline borrowing, which is a useful measure of the fiscal stance.

The CAPD has a downward slope, showing that fiscal support for the economy is being withdrawn consistently over the forecast. This means fiscal policy is helping the MPC to bring inflation back to target. Chart 1.6 shows that fiscal policy is supporting the fight against inflation more so than at the Spring Budget.

The government is taking difficult decisions to repair the public finances, with a negative impulse of 1.0% of GDP on average in the next two years. By the end of the forecast the primary balance reaches a level that is consistent with ensuring that debt falls gradually and sustainably, given the nominal growth rate of GDP and cost of borrowing.

Chart 1.6: Fiscal stance

Inflation is forecast to fall below 3% next year, then sustainably return to target in the medium term.

The OBR forecasts inflation to continue to fall gradually. After reaching a peak of 10.7% in Q4 2022, CPI inflation is expected to be 4.8% in Q4 2023 and fall further to 2.8% in Q4 2024. The OBR expects CPI inflation to average 1.8% over 2025 before returning to the 2% target in the medium term. The OBR says the direct effect of changes to duties at Autumn Statement means CPI is slightly lower in 2024‑25. This builds on the impact government policies have had in helping to bring inflation down, through holding down energy bills under the Energy Price Guarantee (EPG) and cutting fuel duty. The OBR notes a small boost to demand from the government’s policy package, which does not have a material impact on the path of inflation.

High inflation reduces living standards. The OBR expects living standards, as measured by RHDI per person, to fall by 0.8% in 2023-24, before recovering as labour incomes grow faster than inflation. This outlook has improved since Spring Budget 2023. In the year to Q2 2023, RHDI per person was around £800 higher than OBR expected in their March forecast. The OBR’s Autumn Statement forecast shows a fall in RHDI that is half as large as at Spring Budget 2023. The government believes the best way to sustainably improve living standards is to get more people into higher-paid jobs and boost growth, as well as ensuring people keep more of what they earn. The government will continue to provide support to households vulnerable to cost of living pressures. In 2023-24 this includes making Cost of Living Payments and providing £1 billion for the Household Support Fund. From April 2024, rates of the Local Housing Allowance will be increased to the 30th percentile of local market rents to help low income households with housing costs.

The government is keeping spending under control

The government continues to focus on delivering the spending plans agreed at Spending Review 2021. Since those budgets were set, the government has also provided generous funding to ensure key public services continue to deliver. Total departmental spending (DEL) will grow in real terms at 2.6% a year on average over this Spending Review period, and 3.2% a year on average over this Parliament. As a result, total DEL will be around £85 billion higher in real terms in 2028-29 than it was at the start of this Parliament.

Reducing waste and improving efficiency is at the heart of this government’s approach to public spending. The government has therefore driven even greater efficiencies than those set out at Spending Review 2021, and ran an Efficiency and Savings Review last winter to help departments navigate the challenging economic environment and manage pressures caused by high inflation.

Looking forward, higher public sector productivity is necessary to maintain current levels of public service provision without growing the state unsustainably. To tackle this, the Chief Secretary to the Treasury is running an ambitious Public Sector Productivity Programme with all departments to reimagine the way public services are delivered.

The government remains on track to meet its borrowing and debt fiscal rules

Sustainable public finances provide the foundations for economic growth. The government remains committed to fiscal sustainability. The fiscal rules commit the government to reduce borrowing and to get debt falling over the five-year forecast period. The rules require PSND excluding the Bank of England as a percentage of GDP to be falling and PSNB to not exceed 3% of GDP, both by the fifth year of the rolling forecast period.

The OBR has confirmed that the government is on track to meet its borrowing and debt fiscal rules with greater headroom against both rules compared to the spring. Underlying debt begins to fall from 2027-28 and then falls to 92.8% of GDP in the target year (2028-29). The debt rule is met with £13.0 billion headroom in 2028-29, an increase of £6.5 billion since the spring. The borrowing rule is met three years ahead of target and with £61.5 billion headroom, an increase of £22.3 billion since the spring.

The OBR has forecast that the welfare cap will be breached by £8.6 billion in 2024-25. The increase in welfare spending is largely due to more health-related claims for Universal Credit and the government’s decision to provide benefit claimants with more support with the costs of renting private sector housing by increasing the Local Housing Allowance to the 30th percentile in 2024-25. [footnote 21] Nonetheless, the government remains committed to ensuring welfare spending is sustainable in the medium term, as demonstrated by policies announced at Autumn Statement to reduce fraud and error, and reform the welfare system to help people into work.

The government monitors a broad range of fiscal metrics

The Charter for Budget Responsibility includes an aim to strengthen over time a range of measures of the public sector balance sheet, as monitoring these broader metrics helps to ensure that debt is reduced in a sustainable way. [footnote 22] Public sector net worth (PSNW), the total value of the public sector’s assets and liabilities, is expected to be on an improving path as a share of GDP in every year of the forecast. The OBR forecasts PSNW to strengthen from -70.0% of GDP in 2023-24 to -60.0% of GDP in 2028-29, improving faster than underlying debt predominantly due to an increase in the value of government-owned assets. Public sector net financial liabilities (PSNFL), a measure of the financial balance sheet, is forecast to fall from a peak of 83.3% of GDP in 2024-25 to 78.2% in 2028-29.

The government continues to monitor PSND, or headline debt. This is the public sector’s total stock of debt liabilities net of ‘liquid’ assets, it includes the liabilities of the Bank of England and all of its subsidiaries. In recent years, the Bank of England’s Term Funding Scheme and Asset Purchase Facility (APF) have had a large distortive effect on this measure. As the Term Funding Scheme approaches its end, the OBR forecasts PSND and PSND excluding the Bank of England to begin to converge (as shown in Chart 1.7). The sale or redemption of gilts held in the APF also has an effect and after 2026 is the predominant cause of differences between the path of the two measures. When a gilt is sold at a loss the increase in underlying debt is larger than the increase to headline debt.

Chart 1.7: Four measures of the public sector balance sheet

Box 1.e transparency and the asset purchase facility.

The APF is a subsidiary of the Bank of England through which quantitative easing (QE) has been carried out. The APF is indemnified by HM Treasury, so that all profits and losses accrue to HM Treasury. Between January 2013 and September 2022, the APF transferred £123.9 billion of excess cash to HM Treasury. [footnote 23] Since October 2022, HM Treasury has been making cash transfers to the APF to cover losses incurred from higher interest rates, gilt sales and redemptions. [footnote 24]

The eventual lifetime net profit or loss arising from the APF is uncertain and will depend on decisions by the independent MPC and market conditions. Different unwind strategies will impact when losses are incurred but not necessarily change the lifetime profit or loss. Active gilt sales, for example, will incur upfront costs but have the benefit of reducing lifetime net interest costs from carrying gilts on the APF’s portfolio.

Central banks have different arrangements with national treasuries for sharing profits and losses related to QE, and as highlighted by the Organisation for Economic Cooperation and Development, many are now incurring such losses. [footnote 25] Since national governments are the beneficial owners of central banks, asset purchases that were undertaken on central bank balance sheets will ultimately flow through to government finances. Differences in arrangements result in variation in the transparency, time profile and mechanism of how losses materialise and how the fiscal impacts are recorded.

The UK approach of indemnifying the APF is in line with best practice as set out in a recent IMF working paper, relating to several areas of governance, accountability, and transparency. [footnote 26] The indemnity supports accountability by making the costs and risks from large scale asset purchases explicit. Historical and projected income flows made publicly available by the independent OBR provide extensive transparency around the fiscal impact of QE. This is supported by regular reporting by HM Treasury and the Bank of England and the publication of public sector statistics which capture APF impacts.

As set out in Box 1.C, best practice fiscal management requires transparency about the government’s potential obligations. Table 1.2 provides an update on all new significant contingent liabilities taken on since the last update at Spring Budget 2023. The expected loss of these contingent liabilities is £1.3 billion, of which £1.1 billion supports the Government of Ukraine through World Bank guarantees. Other contingent liabilities include the Shipbuilding Credit Guarantee Scheme provided by the Department for Business and Trade and an extension to HM Treasury’s Mortgage Guarantee Scheme.

Table 1.2: Newly-approved contingent liabilities since Spring Budget 2023

Forecast summary, table 1.3: overview of the obr’s economic forecast(1), table 1.4: overview of the obr’s fiscal forecast (% gdp), reducing debt.

Sustainable public finances provide the foundations for economic growth, which is why the government is committed to reducing debt. The government remains committed to fiscal sustainability. It has taken the difficult but necessary decisions to get debt falling and ensure our public services continue to operate effectively in the face of financial and operational pressures.

The OBR forecast shows that, compared to Spring Budget 2023, borrowing is lower on average across the forecast and debt as a proportion of GDP is lower in every year. The government is on track to meet its borrowing and debt rules, with improved headroom in the fifth year of the forecast.

To support these aims, the government continues to focus on delivering the spending plans agreed at Spending Review 2021. It is also taking targeted action against non-compliance in the tax system. Looking forward, the government is committed to reimagining the way it delivers public services through the Public Sector Productivity Programme. This aims to place public spending on a sustainable footing over the long-term and maximise value for the taxpayer.

Public spending

Spending Review 2021 set UK government departments’ resource and capital Departmental Expenditure Limit (DEL) budgets and the devolved administrations’ block grants from 2022-23 to 2024-25. It took action to repair the public finances following the historic shock of the COVID-19 pandemic and increased departmental spending accordingly.

Since those budgets were set, the government has also provided generous funding to ensure key public services continue to deliver.

• The Autumn Statement reaffirms the commitments made at Autumn Statement 2022 to provide additional support to the NHS and adult social care in England in response to the pressures facing the health service. More detail is provided in box 2.A below.
• The government has announced its ambition to introduce the Advanced British Standard in England, a new Baccalaureate style qualification, which will provide greater breadth of study, improve essential literacy and numeracy skills, and ensure technical and academic education are put on equal footing. The government has also provided additional education funding since Spending Review 2021. Together, additional funding for schools announced since Spending Review 2021 totals more than £2.4 billion in 2023-24, and more than £2.8 billion in 2024-25. [footnote 27] This will bring per pupil funding to its highest ever level in real terms in 2024-25. [footnote 28] At Spring Budget 2023, the government committed to providing an extra £4.1 billion for childcare by 2027-28 to facilitate the expansion of the new free hours offer, which will bring total investment in childcare to over £8 billion. [footnote 29]

Following Putin’s illegal invasion of Ukraine in February 2022 the UK has been at the forefront of the international response. The UK, along with our partners, has implemented one of the most severe packages of sanctions on a major economy, undermining Putin’s ability to fund his illegal war. The UK has also been one of the largest bilateral donors to Ukraine. The UK’s total military, humanitarian, and economic support for Ukraine to date amounts to over £9.3 billion. This includes £4.6 billion in military support over 2022-23 and 2023-24, leveraging support from others and making a crucial difference on the battlefield, and £347 million in humanitarian aid over three years to 2025. [footnote 30] Since February 2022 the UK has played a critical role in providing fiscal support to Ukraine, pledging a total of £4.7 billion to bolster Ukraine’s economy. This includes through World Bank loan guarantees supporting the inception of the IMF’s programme to support Ukraine, as well as through direct bilateral assistance. [footnote 31] This has played a crucial role in supporting the government of Ukraine in withstanding Russian aggression.

Alongside this, the government continues to invest in infrastructure, and will deliver over £600 billion of planned public sector investment over the next 5 years, underpinning our future growth and supporting energy security, Net Zero and our vital public services. In 2024-25, we are investing over £30 billion more in real terms than at the start of this Parliament. [footnote 32]

Total departmental spending (DEL) will grow in real terms at 2.6% a year on average over this Spending Review period, and 3.2% a year on average over this Parliament. [footnote 33]

A focus on improving efficiency and productivity is at the heart of this government’s approach to public spending. Spending Review 2021 set out an ambitious programme to drive out inefficient spend, confirming savings of 5% against day-to-day central departmental budgets in 2024-25, which have been reinvested in priority areas. [footnote 34]

The government has maintained a consistent focus on tackling waste across the public sector to maximise value for money for the taxpayer, building on the functional efficiency programme, which delivered £3.4 billion of audited savings in 2020-21 and £4.4 billion of audited savings in 2021-22. [footnote 35] This work includes:

• Delivering a property sales programme, which has generated more than £1 billion in receipts to be reinvested in improving the government estate. [footnote 36]
• Launching our Roadmap for Digital and Data, which commits to elevating 50 government services to a “great” standard and streamlining access to government services via the One Login and Find a Grant programmes. [footnote 37] One Login is expected to help save over £700 million over the next three years. [footnote 38]
• Passing the Procurement Bill, which consolidated over 350 different procurement regulations and will enable more flexible procurement procedures across government. [footnote 39]
• Setting up a new Public Sector Fraud Authority (PSFA) that aims to put counter-fraud at the heart of decision-making. The PSFA brings a greater focus on counter-fraud performance and outcomes, will provide an increased depth and breadth of support to public bodies, and is using cutting edge analytics and technology to find and stop fraud. In its first year of operation, 2022-23, the PSFA saved taxpayers £311 million. [footnote 40]
• Delivering the Public Bodies Review Programme, to scrutinise the work and effectiveness of arm’s length bodies (ALBs). The programme will deliver savings of at least 5% of ALBs’ day-to-day resource budgets that will be reinvested into frontline priorities. Through this programme the government aims to review 40 public bodies in 2024-25.
• Launching the Government Efficiency Framework (GEF) in July 2023. The GEF will standardise and improve how departments report efficiency savings and puts in place consistent reporting processes and oversight to make sure efficiency savings are delivered. [footnote 41]

Last winter the government also ran an Efficiency and Savings Review to help departments navigate the challenging economic environment and manage pressures caused by high inflation. Departments reprioritised to ensure the government can continue to protect the vital frontline services that matter most to the public.

Box 2.A Additional support for the health service

• The government has provided record levels of funding to the NHS and adult social care in England. At Autumn Statement 2022, up to £8 billion of additional funding was made available. This resulted in a total NHS budget of £162.5 billion for 2024-25 in England, 45% higher than 2018-19 in cash terms. [footnote 42] This level of investment is enabling rapid action to improve urgent and emergency care and tackle the elective backlog, as set out in the recovery plans published in January and February respectively, and the primary care recovery plan published in May. The government built on this support with £200 million of new funding announced in September 2023 to boost NHS resilience and ensure patients receive the care they need this winter.
• The Autumn Statement recommits to the NHS Agenda for Change pay deal announced this year, including the non-consolidated payment for 2022-23, which was paid out from June 2023. [footnote 43]
• The government is taking significant steps to support the long-term sustainability of the health service. The Prime Minister announced in October plans to create the first smoke-free generation, including a historic new law with the potential to prevent up to 115,000 cases of strokes, heart disease, lung cancer and other lung diseases. [footnote 44]
• The government also announced in June an additional £2.4 billion investment over the next five years to back the first ever NHS Long Term Workforce Plan, underpinned by an assumption of labour productivity increasing by 1.5-2% per year alongside the biggest expansion of staff training in NHS history. [footnote 45] Starting with 205 extra medical school places in 2024, the plan will set the NHS in England on the path to double the number of medical school places and almost double the number of adult nursing places by 2031.
• The UK’s security and prosperity are dependent on creating a healthier, safer, and more resilient world, and the World Health Organisation (WHO) plays a key part in that. The government is increasing its core funding to the WHO by £2 million for underfunded priorities such as patient safety, reinforcing the UK as the largest donor of fully flexible funds.

Public Service Pension Schemes (PSPS) are in the process of finalising outcomes of the 2020 valuations, which will determine employer contribution rates for PSPS from April 2024 onwards. These valuations are based on the revised Superannuation Contributions Adjusted for Past Experience (SCAPE) discount rate. Following a review of the SCAPE methodology, and the latest OBR forecast of expected long-term GDP growth, HM Treasury confirmed the new SCAPE discount rate of 1.7%+CPI p.a. on 30 March 2023. [footnote 46] The government has committed to providing funding for the increased cost of employer contributions from April 2024 for centrally funded employers.

As confirmed at Autumn Statement 2022, the government is committed to returning to spending 0.7% of Gross National Income (GNI) on Official Developmental Assistance (ODA) when, on a sustainable basis, the government is not borrowing for day-to-day spending and underlying debt is falling. In accordance with the International Development (Official Development Assistance Target) Act 2015, the government will continue to review and confirm each year whether a return to spending 0.7% of GNI on ODA is possible against the latest fiscal forecast with spending assumed at around 0.5% of GNI until then. The independent OBR forecasts show that the principles for a return to 0.7% GNI confirmed by Parliament in 2021 have not been met in 2024-25.

Box 2.B The government’s response to the conflict in Israel and Gaza

2.b.1 overview.

• Following Hamas’ terrorist assault against Israel on 7 October, the UK has been at the forefront of efforts to provide support in the immediate region and to affected communities in the UK.
• To date, the government has facilitated flights carrying almost 1,000 people to the UK. [footnote 47] The safety of British nationals remains our top priority and the government will continue to look at how it can support those who remain in Israel and Gaza.

2.B.2 UK support to date

2.b.2.1 humanitarian support.

• The UK supports Israel’s legitimate right to defend itself and take action against terrorism but has been clear that all parties must comply with international humanitarian law and take every possible step to minimise harm to civilians.
• Since 7 October, the UK has committed £30 million in additional aid to the Occupied Palestinian Territories – more than doubling our existing aid commitment (£27 million) for this year. [footnote 48] This will allow trusted partners to provide essential humanitarian relief items and services such as food, water, and shelter.

2.B.2.2 Maintaining regional stability

• The UK is focused on working with international partners to help prevent a damaging and destabilising escalation in the region.
• The Royal Navy have deployed a task group to the eastern Mediterranean, supported by the Royal Air Force patrolling the skies – they are working with partners in the region to deter those who may seek to escalate tensions and are monitoring threats to regional stability, including the transfer of weapons to terrorist groups.
• The Foreign Secretary has also announced a package of sanctions against Hamas senior leaders and financiers as part of efforts alongside our allies to disrupt the group’s ability to finance and carry out its acts of terror.

2.B.2.3 Support for affected communities within the UK

• The government recognises the conflict has affected communities both abroad and at home and has been clear that hate crime of any kind will not be tolerated. The UK is a multinational, multi-ethnic, and multi-faith society where our strengths and values are rooted in our culture and our laws. The government is working with local communities throughout the UK in ensuring these values are upheld, and there is support in place for those affected.
• That is why the government has provided £3 million of additional funding this year to the Community Security Trust, an organisation established to protect British Jews from antisemitism and related threats. This funding will be maintained next year, bringing annual protective security funding for the Jewish community for 2023-24 and 2024-25 to £18 million.
• The government is also investing up to a further £7 million over the next three years for organisations like the Holocaust Educational Trust to help tackle antisemitism. This funding will ensure support is in place for schools and universities to understand, recognise, and deal with antisemitism effectively.

Table 2.1: Resource Departmental Expenditure Limits (DEL) excluding depreciation

Table 2.2: capital departmental expenditure limits (del).

The government is confirming the assumption for the future path of departmental spending. This will follow the profile set at Spring Budget 2023. After this Spending Review period, planned departmental resource spending will continue to grow at 1% a year on average in real terms, excluding the funding provided to local authorities in 2024-25 as part of the one-year Retail, Hospitality, and Leisure relief scheme. Departmental capital spending will follow the cash profile agreed at Spring Budget 2023, with new commitments funded in addition to this, including further support for levelling up programmes and business access to finance.

As a result, total departmental spending (DEL) will be around £85 billion higher in real terms by 2028-29 than it was at the start of this Parliament (2019-20). Departmental resource and capital budgets beyond 2024-25 will be set at the next Spending Review.

The government rightly provided unprecedented levels of support in response to the COVID-19 pandemic and the energy crisis. As the economy recovers from these shocks, this extraordinary support should subside accordingly to prevent permanent growth in the size of the state. As such, Total Managed Expenditure (TME), the total amount of money that the government spends through departments, local authorities, other public bodies, and social security, is forecast to fall in each year of the forecast period as a share of the economy. This follows an increase since 2019-20 as illustrated in Chart 2.2.

As a result of decisions at the Autumn Statement, the devolved administrations are receiving over £1 billion in additional funding through the Barnett formula over 2023-24 and 2024-25. The Scottish Government is receiving £545 million, the Welsh Government £305 million, and the Northern Ireland Executive £185 million. [footnote 49]

Chart 2.1: Total Departmental Expenditure Limits (DEL)

Source: HM Treasury and Office for Budget Responsibility.

Chart 2.2: Total Managed Expenditure (% GDP)

Source: Office for National Statistics, Office for Budget Responsibility, and HM Treasury calculations.

Table 2.3: Total Managed Expenditure (TME)

Improving public sector productivity.

While day-to-day spending will continue to grow above inflation in future years, public spending faces many pressures. The government will get the most out of every pound spent by boosting public sector productivity and by focusing spending on the government’s priorities.

The government has already identified significant opportunities in key public services:

• The recently published independent Policing Productivity Review has made a series of recommendations to improve police productivity. These proposals range from building on recently introduced measures that cut unnecessary bureaucracy to driving greater productivity through the adoption of new and improved technology. If all of these were implemented, they could save up to 38 million hours of police officer time per year, the equivalent of an additional 20,000 police officers. [footnote 50]
• The NHS Long Term Workforce Plan will help deliver a more productive NHS and is underpinned by an assumption of 1.5-2% per annum growth in labour productivity over the next 15 years. This includes a more preventative model of care being provided further upstream and closer to home. Over the period of the Plan the total community workforce will nearly double in size to enable more care to be delivered outside of hospital settings. The Plan will also mean NHS staff working and training in different ways, building broader teams with flexible skills, as well as having the right skills to make full use of new technology that reduces the time for administrative tasks and gives clinicians more time to care. The NHS will also take advantage of opportunities that innovation and technology can offer, including identifying where AI can be used to automate administrative tasks, as well as improving the accuracy and efficiency of diagnostic tools.

Building on this, the Public Sector Productivity Programme has focused on:

• Creating a modern and efficient public sector workforce. As a first step, the size of the Civil Service has been capped. The Civil Service, excluding devolved administrations, has grown by around 66,000 since 2019; capping headcount at current levels could save up to £1 billion by March 2025. [footnote 51] To go further after the current Spending Review period, government departments will be asked to produce plans to reduce the size of the civil service to pre-pandemic levels by the end of the next Spending Review period.
• Reducing the amount of time our key frontline workers, including police, doctors, and nurses, spend on administrative tasks. Some frontline workers can spend at least 8 hours per week on administrative tasks. Reducing this could allow frontline workers to spend more time supporting patients, pupils, and delivering for the public.
• Embracing the opportunities presented by making greater use across the public sector of cutting-edge technology like Artificial Intelligence (AI). The potential productivity benefits from applying AI to routine tasks across the public sector are estimated to be worth billions. As part of this, the Deputy Prime Minister recently announced a new Incubator for Artificial Intelligence, an elite team of technical experts at the heart of government that will help departments to harness the potential of AI to improve lives and the delivery of public services.
• Strengthening preventative action to reduce demand on public services, by ensuring that the government intervenes early to prevent problems arising and, in turn, reduces the chance of these problems becoming embedded. This will build on a number of prevention-related pilots currently funded through the Shared Outcomes Fund, such as trialling workplace health checks to spot early signs of heart disease and testing new models to improve access to specialist support in primary schools for neurodiverse pupils. [footnote 52]

Alongside this, the audit of Equality, Diversity, and Inclusion (EDI) spending is coming to conclusion and, subject to further work, the Government is considering introducing a presumption against external EDI spending and increasing ministerial scrutiny of EDI spending whilst streamlining EDI training and HR processes with a view to getting value for the taxpayer. The Minister for the Cabinet Office will be outlining the final proposals, in due course.

As well as mainstreaming AI, the government is also exploring the use of other cutting-edge technologies, including quantum, in the public sector. The National Quantum Computing Centre is supporting government and industry to explore how quantum computing could be applied and HMG has launched a Catalyst fund bringing together quantum innovators and government departments to identify and develop near- and longer-term applications.

In June the Chancellor commissioned the National Statistician to run a review to improve the measurement of public sector productivity. As part of the conclusion of the first phase of the ONS’s Public Services Productivity Measurement Review, the ONS has published new experimental baseline estimates for public service productivity from 1997 including nowcasts for 2021 and 2022. [footnote 53] The Review will now proceed to further develop and evaluate new methods and data sources to improve estimates, coverage, and accuracy of public sector productivity measurement. This will deliver early results in Spring 2024 with further improvements on a regular basis after this.

Tackling the Tax Gap

The government is committed to a tax system that is easy for businesses and individuals to engage with, and where everyone pays their fair share. The Tackling the Tax Gap package of measures is the largest since 2016, raising £5 billion of tax revenue over the next five years, which will contribute to funding our public services. [footnote 54]

The government is investing in HMRC’s ability to support individuals and businesses who are unable to pay their tax debts by increasing HMRC’s debt management resource. This will allow HMRC to better target their debt collection activity, pursuing those with tax debts that can afford to pay, and providing support to those that are temporarily unable to pay. The government is also taking action against those who continue to bend or break the rules, by reducing opportunities for tax fraud in the construction industry and taking strong action against promoters of tax avoidance.

Cutting Taxes and Rewarding Work

The government is committed to ensuring work always pays and reforming the welfare system to help people work, where they are able to. In support of this aim, the government is announcing tax cuts for 29 million people.

The government is also expanding the support on offer to help those with a long-term sickness or disability and those who are long-term unemployed to get into work, as well as reforming the Work Capability Assessment (WCA) so that more people are able to access the support on offer. Increasing the number of people in work in this way will grow the economy without putting upwards pressure on inflation.

The Office of Budget Responsibility (OBR) have judged that the Autumn Statement package will not only bring 78,000 people into the labour market, but will also significantly increase the numbers of hours worked in the economy. This means that the combined impacts of the Spring and Autumn policy measures will increase the number of people in employment by around 200,000 by the end of the forecast.

The best way to improve living standards in the long-term is to get more people into higher paid jobs. However, the government recognises that short-term cost of living pressures remain, particularly impacting vulnerable groups. This year the government is providing support through Cost of Living Payments to households on means-tested-benefits, those on disability benefits, and pensioners, and next year will raise the Local Housing Allowance to support low-income families with housing costs. The government will also protect the State Pension Triple Lock and uprate working age benefits in line with inflation.

Cutting taxes

The government has had to take difficult decisions to restore the public finances in the wake of the economic shocks caused by COVID and Putin’s illegal invasion of Ukraine. But with inflation falling, the economy growing in every year of the forecast and debt set to fall, that hard work is starting to pay off. This means the government is now in a position where it can start to return some money to taxpayers.

Allowing working families to keep as much of their hard-earned money as possible in a sustainable way is a priority for this government, and rewarding work is part of the long-term plan to grow the economy. This is why the government is building on the largest ever increase to National Insurance starting thresholds in 2022, by cutting taxes for 29 million working people and reforming the tax system, which the OBR believe will increase the number of people in employment by 28,000 by 2028-29. [footnote 55] As a result of these cuts and above-inflation increases to personal tax thresholds since 2010, an average worker on £35,400 will pay over £1,000 less in personal taxes in 2024-25 than they otherwise would have done. [footnote 56]  Taxes are being cut for employees and the self-employed through a number of changes.

Firstly, the current combined rate of income tax and National Insurance contributions (NICs) for employees paying the basic rate of tax is too high at 32%. The government will address this by cutting the main rate of Class 1 employee NICs from 12% to 10%. This will provide a tax cut for 27 million working people with the average worker on £35,400 receiving a tax cut in 2024-25 of over £450. [footnote 57] By cutting taxes on work, the government is rewarding employees and providing a combined rate of income tax and NICs for an employee paying the basic rate of tax of 30% – the lowest since the 1980s. [footnote 58] This change will make sure work pays, and in 2024-25:

• an average full-time nurse on £38,900 will receive an annual gain of over £520; [footnote 59]
• an average teacher on £44,300 will receive an annual gain of over £630; [footnote 60]
• an average police officer on £44,300 will receive an annual gain of over £630; [footnote 61]
• a typical junior doctor on £63,000 will receive over £750; [footnote 62] and
• working families with two earners on the average income will receive a gain of £900.

This will take effect from 6 January 2024 so that employees benefit as soon as possible. While rate changes usually take effect from 6 April, the government wants to provide people with money in their pockets now and is therefore delivering this as quickly as possible. This will ensure that employees benefit from this tax cut from January onwards as employers make this change to their payroll systems.

Secondly, the government values the work of the self-employed who contribute so much to the economy. Therefore, the government will support the self-employed by cutting the main rate of Class 4 self-employed NICs from 9% to 8% from 6 April 2024. This will benefit around 2 million individuals, recognising the contribution of the self-employed and ensuring that work pays for all.

Finally, the current NICs system is needlessly complicated for the self-employed who have to pay two separate NICs charges in order to access contributory benefits. Therefore, the government will reform the tax system by abolishing Class 2 self-employed NICs. From 6 April 2024, no one will be required to pay Class 2 self-employed NICs. Self-employed individuals with profits above £12,570 are currently required to pay a weekly flat rate of Class 2 NICs, which would have risen to £3.70 from 6 April 2024. The details of this change are:

• From 6 April 2024, self-employed people with profits above £12,570 will no longer be required to pay Class 2 NICs, but will continue to receive access to contributory benefits, including the State Pension.

Those with profits between £6,725 and £12,570 will continue to get access to contributory benefits including the State Pension through a National Insurance credit without paying NICs as they do currently.

Those with profits under £6,725 and others who pay Class 2 NICs voluntarily to get access to contributory benefits including the State Pension, will continue to be able to do so.

• The main rate of Class 2 NICs is usually uprated by Consumer Price Index (CPI) and therefore had been due to rise to £3.70 per week in April 2024. For those paying voluntarily, the government has decided to maintain the current rate of £3.45 per week for 2024-25.

The government will set out next steps on Class 2 reform next year. As part of this reform the government will protect the interests of lower paid self-employed people who currently pay Class 2 NICs voluntarily to build entitlement to certain contributory benefits including the State Pension. This is a progressive reform, giving lower-paid self-employed individuals a significant tax cut. It simplifies the system for self-employed taxpayers, reducing needless complexity, freeing up valuable time for them to grow their businesses rather than interacting with the tax system. This builds on the Spring Statement 2022 decision to ensure that self-employed individuals with profits between the Small Profits Threshold and Lower Profits Threshold could continue to build up National Insurance credits without paying Class 2 NICs.

This will mean that a self-employed person who pays Class 2 NICs every week will save at least £192 per year. Together with the cut to Class 4 NICs around 2 million self-employed people will benefit, with an average self-employed person on £28,200 saving £350 in 2024-25. [footnote 63]

These changes build on the historic increases to NICs starting thresholds in 2022 which mean that a UK employee can earn more before paying tax or social security contributions than an employee in any other G7 country. [footnote 64] The action taken today provides a tax cut worth over £9 billion per year – the largest ever cut to employee and self-employed National Insurance. [footnote 65] These NICs cuts and above inflation increases to thresholds since 2010 mean that an average worker on £35,400 will pay over £1,000 less in personal taxes in 2024-25 than they otherwise would have done. 

Ensuring work pays

To make sure that work always pays, the government will deliver on its commitment for the National Living Wage (NLW) to meet two-thirds of median earnings. From 1 April 2024, the NLW will increase by 9.8% to £11.44 an hour with the age threshold lowered from 23 to 21 years old, ending hourly low pay. This represents an increase of over £1,800 to the annual earnings of a full-time worker on the NLW and is expected to benefit 2.7 million low paid workers. [footnote 66] [footnote 67]

From April, take-home pay for someone on the NLW (not in receipt of tax credits or Universal Credit) will have increased in real terms by more than 30% since 2010 (Chart 3.1).

Chart 3.1: Net annual earnings for a full-time worker on the National Living Wage in cash terms (bars) and real terms (line)

Source: Office for National Statistics (Consumer price inflation time series – MM23), Office for Budget Responsibility, historical NMW/NLW rates, historical tax/NI bands and rates. HM Treasury calculations.

Reforming welfare to support people into work

Increasing labour market participation, and rewarding work, remains a key priority for the government. It is important for growing the UK economy sustainably, controlling spending and improving living standards. Getting more people into good jobs is beneficial to those individuals and the best route out of poverty.

Since 2010, the government has been successful in reducing unemployment. Over the period Q1 2010 to Q3 2023 (inclusive), the UK unemployment rate fell by 3.8 percentage points, the third largest percentage point decline among the G7 countries, more than Canada, Japan, France and more than triple the fall in Italy, with only the US and Germany having had a greater reduction. [footnote 68]

However, whilst the UK has made significant progress in reducing unemployment, inactivity – people of working-age neither in work nor looking for or available for work – remains an issue. The UK’s inactivity rate is currently higher than the best performing G7 comparators. While the UK’s inactivity rate is lower than the US, France and Italy, the UK is the only G7 country to have seen an increase in the inactivity rate since Q4 2019. [footnote 69]

Whilst there are many reasons for labour market inactivity, including study and caring responsibilities, the recent rise in inactivity since the onset of the pandemic due to ill-health and disability is particularly concerning. [footnote 70] In its 2023 Fiscal Risks and Sustainability (FRS) report, the OBR highlighted the significant impact rising health-related inactivity is having on the UK’s medium-term economic growth prospects and the public finances, reducing tax receipts by an estimated £8.9 billion and increasing welfare spending by an estimated £6.8 billion in 2023‑24. [footnote 71]

Box 3.A Labour market tightness has eased since the spring, but inactivity remains a key economic challenge

Office for National Statistics (ONS) experimental estimates indicate that the working-age inactivity rate has fallen from 21.4% in Q4 2022 to 20.9% in Q3 2023. This is likely to reflect an unwinding of temporary factors, such as the increase in student inactivity observed over the pandemic. Alongside this, ONS experimental estimates also suggest the unemployment rate has risen, increasing to 4.2% in Q3 2023, up from 3.8% in Q4 2022. [footnote 72]

Despite falls in the headline rate of inactivity, ONS experimental estimates suggest there are still over 350,000 more people of working-age inactive than before the pandemic. The number of people who are inactive due to long-term sickness or disability has also continued to rise since the spring, reaching a record 2.6 million in the latest published data for the three months to July 2023. [footnote 73] This is consistent with Department for Work and Pensions (DWP) benefit caseload data which indicates the numbers of people claiming incapacity benefits (who have Limited Capability for Work and Work Related Activity (LCWRA)) has increased by 0.7 million, to around 2.4 million, since May 2019. [footnote 74]

The government is now building on the policies announced at Spring Budget 2023, which the OBR had forecast would have an overall impact on GDP of around 0.2% in 2027-28. [footnote 75] That package focused support towards those groups where employment support was most needed. The policies included:

• For parents, removing one of the biggest barriers to parents working, by substantially increasing the amount of free childcare that working families can access. All eligible working parents in England will be able to access 30 hours of free childcare per week for 38 weeks per year from when their child is 9 months old, to when they start school
• To extend working lives, enhancing the digital strand of the midlife MOT offer, and removing the Lifetime Allowance charge, raising the Annual Allowance, and increasing the Money Purchase Annual Allowance to stop these limits acting as a barrier to remaining to work
• For those with a health condition or disability, embedding employment support within mental health and musculoskeletal health (MSK) services in England, digitising the NHS Health Check, publishing the Health and Disability White Paper and introducing a new Universal Support programme to support people with disabilities and long-term sickness into work
• For welfare recipients, increasing work coach support and work search requirements, including increasing the Administrative Earnings Threshold (AET), strengthening the way the sanctions regime is applied, extending the Youth Offer and expanding the Additional Job Centre Support Pilot.

The Back to Work Plan

At Autumn Statement, the government builds on this through its Back to Work Plan, which includes investment of over £2.5 billion over the next five years, and which will significantly expand available support and transform the way people interact with the benefits system. It has been designed to support those who are long-term unemployed to find work, and to ensure that those with long-term sickness or disabilities are better equipped to manage their conditions and participate in work, if they are able to do so.

Supporting the long-term unemployed into work

The latest data for the three months to July shows there were around 300,000 people who had been unemployed for over a year: a fifth of the UK’s overall unemployed population. [footnote 76] The proportion of unemployed people out of work for over a year is significantly higher in the UK than the top performing countries in the OECD. [footnote 77]

The longer someone spends out of work, the harder it becomes for them to find a job. [footnote 78] Minimising the time people spend unemployed is therefore vital to increasing labour supply while helping individuals realise the social, health and financial benefits that meaningful work brings.

As part of the Back to Work Plan the government will invest over £1.3 billion over the next five years to help tackle long-term unemployment by establishing an end-to-end process that supports and incentivises unemployed Universal Credit claimants to find work. These policies, which include expanding Additional Jobcentre Support and strengthening Restart, build on the comprehensive welfare package announced at Spring Budget 2023, which increased work coach support for claimants.

To incentivise compliance, the government will strengthen the Universal Credit sanctions regime. This will further enforce the government’s expectation that those who can work must engage with the support available or lose their benefits:

• the government will target claimants who continue to disengage with Jobcentre support by closing the claims of individuals who have been on an open-ended sanction for over six months and who are solely eligible for the Universal Credit standard allowance. This will also end their access to additional benefits such as free prescriptions and legal aid
• to root out fraud and error, the government will use the existing Targeted Case Review process to review the Universal Credit claims of disengaged claimants who have been on open-ended sanctions for over 8 weeks, ensuring they receive the right entitlement
• the government will track claimants’ attendance at job fairs and interviews organised by Jobcentres so that work coaches have the information they need to determine whether claimants are meeting their commitments. The government will look to build on these changes in the future to further integrate employers into Jobcentre processes and improve oversight of claimants’ work search activities.

The Back to Work Plan provides enhanced support, delivered across three phases of a claimant’s work search journey, with interventions intensifying the longer a claimant remains unemployed:

• phase 1 : unemployed claimants across Great Britain will receive regular support from a work coach to search for and move into work. To strengthen the government’s understanding of how early interventions can best help claimants find work or increase their income, the government has expanded Additional Jobcentre Support , currently live in 90 Jobcentres. [footnote 79] , [footnote 80] This will test the impact of intensive support 7 weeks into a claimant’s work search journey, building on the pilot announced at Spring Budget 2023 to test the impact of interventions at 13 and 26 weeks
• phase 2 : if a claimant in England and Wales has failed to find a job after 6 months, they will be referred to an expanded and improved Restart . The scheme will provide 12 months of intensive, tailored support to tackle barriers to employment, with more expectations placed on claimants and eligibility expanded to include those who are 6 months, rather than 9 months as now, into their work search journey. Support will include coaching, CV and interview skills, and training sessions. Work coaches will track the activity of participants to ensure they comply with the scheme’s requirements
• phase 3: claimants in England and Wales who are still unemployed after 12 months on Restart will take part in a claimant review point : a new process whereby a work coach will decide what further work search conditions or employment pathways would best support them into work. If no suitable local job is available immediately, claimants will be required to accept a time-limited mandatory work placement or take part in other intensive activity, designed to increase their skills and improve their employability. If a claimant refuses to accept these new conditions without good reason, their Universal Credit claim will be closed. This model will be rolled out gradually from 2024.

As a result of these reforms, no claimant should reach their claimant review point at 18 months of unemployment in receipt of their full benefits if they have not taken every reasonable step to comply with Jobcentre support.

The government will also take further action on fraud and error by legislating to increase the DWP’s access to data on benefit claimants that is held by third parties (e.g. banks). This will enable DWP to better identify fraud in the welfare system, especially in detecting fraudulent claims where there is undeclared capital, which is the second highest type of welfare fraud. These extra powers are estimated to generate around £300 million per year savings by 2028-29. [footnote 81]

Supporting the long-term sick and disabled into work

The government announced a wide-reaching package at Spring Budget 2023 including reforms to help those with disabilities and health conditions. The Back to Work Plan builds on this and includes investment of almost £1.3 billion over the next five years to deliver a significant expansion of work and health support as well as reforms to the way people who fall ill interact with the state.

By giving people greater access to mental health treatment and employment support the government aims to improve their health outcomes, providing both a better quality of life and increasing their chances of staying in or returning to work sooner.

Expansion of employment support and available treatments

Between 2019 and 2023, the number of people inactive because of long-term sickness who reported a mental health condition rose by over 35%. [footnote 82] To counter this trend, the government is committing £795 million over the next five years to tackle the root causes of mental health problems and support people to remain in or return to work, providing support for an additional half a million people over five years.

The government will expand Individual Placement and Support for Severe Mental Illness , the employment support service within community mental health teams, aiming to help people gain and retain paid employment, offering an additional 100,000 places over five years. The government will also expand Talking Therapies , the flagship NHS England programme for treatment of mild and moderate mental health conditions. Funding will be provided to increase the number of sessions per course of treatment as well as broaden access, leading to an expected additional 384,000 people completing a course of treatment by 2028‑29. [footnote 83]

The government will also increase the annual number of placements available on Universal Support to 100,000 in England and Wales, doubling its commitment at Spring Budget 2023. The programme matches long-term sick and disabled participants with suitable vacancies, based on their preferences, strengths and any lessons learnt from previous work experience. It also funds support of up to £4,000 per participant, such as for relevant training or employer adjustments, to ensure that they can succeed in their roles.

Reform to the way people who fall ill interact with the state

Following a consultation, the government is reforming the activities and descriptors in the WCA to better reflect the greater flexibility and reasonable adjustments now available in the world of work. [footnote 84] This reform will prevent some individuals from being deemed as not fit for work, and ensure they are better supported into employment. These changes will apply to new claims only when the reform is implemented from 2025 onwards.

In the absence of Autumn Statement policies, the OBR forecast that the combined number of people in the Universal Credit LCWRA group and the Employment and Support Allowance Support Group (ESA SG) was due to increase from around 2.4 million individuals in 2023‑24 to around 2.9 million individuals in 2028‑29. [footnote 85] The government’s WCA reforms have significantly reduced this, more than halving the net flows into LCWRA and ESA SG over five years and ensuring that more individuals receive the right work and health support at the right time. [footnote 86]

The government will also explore end-to-end reforms of the fit note process to support more people to resume work after a period of illness. As part of this, trailblazer trials in a small number of Integrated Care Systems in England will test changes to increase access to health and employment support for those who have received a fit note for a prolonged period of time. The government will launch a consultation in 2024 on wider reforms, to examine options for improving fit note assessments and integrating quicker access to specialised employment and health support.

Working with employers to support their employees

Employers can play a key role in preventing sickness leading to long-term economic inactivity. Over 9 million people in work have a long-term health condition and the government wants to collaborate with employers to help them play their part in preventing their employees from becoming inactive due to ill-health. [footnote 87]

Provision of high-quality Occupational Health (OH) is important for helping employees with disabilities and long-term health conditions to stay in work. Following the recent consultation, the government will meet employers’ requests for clearer guidance and support by establishing an expert group to develop a new voluntary OH framework in Great Britain. [footnote 88] The full consultation response outlines further detail. The government will also work with employers and business representatives to develop and promote best employment practices for employees with health and disability issues.

Supporting vulnerable households

Over the last two years, the government has demonstrated its commitment to supporting the most vulnerable. In response to the energy crisis, the government provided one of the largest support packages in Europe. [footnote 89]

The government has provided significant energy support this year and last through the Energy Price Guarantee (EPG) and Energy Bills Support Scheme (EBSS) which together paid for almost half of the typical family’s energy bill from October 2022 to June 2023. [footnote 90] This is in addition to the benefits uprating and support for vulnerable households announced last year, which included new Cost of Living Payments in 2023-24 and a £1 billion extension of the Household Support Fund.

In June, the government also announced the Mortgage Charter to support residential mortgage customers. This Charter sets out the standards that Signatory Lenders – who represent over 90% of the UK mortgage market – will adopt when helping their customers. [footnote 91] This offers mortgage holders greater flexibility in managing their finances and offers protections against repossession.

It is partly as a result of these measures that growth has been stronger than expected this year, as resilient real incomes, in aggregate, supported consumption. Inflation has more than halved from its 2022 peak, though remains too high. [footnote 92] The government continues to support the Monetary Policy Committee (MPC) in its action to bring inflation down to the 2% target by keeping borrowing under control.

High inflation reduces living standards. The OBR expects living standards, as measured by real household disposable income (RHDI) per person to fall by 0.8% in 2023-24, before recovering as labour incomes grow faster than inflation. This outlook has improved since Spring Budget 2023. In the year to Q2 2023, RHDI per person was around £800 higher than the OBR expected in their March forecast. The OBR’s Autumn Statement forecast shows a fall in RHDI that is half as large as at Spring Budget 2023. [footnote 93] This pressure on real incomes is not spread equally, with some households more exposed than others, particularly to higher interest rates, rental costs and food and energy prices. [footnote 94]

Over 2023-24, the government is providing targeted support to the most vulnerable, through Cost of Living Payments, to 8 million UK households on eligible means-tested-benefits, 8 million pensioner households and 6 million people across the UK on eligible disability benefits. [footnote 95] Local Authorities will also be able to continue supporting households with the cost of essentials through the £1 billion provided for the Household Support Fund this year.

Going further, to support households that need most help to pay their rent, the government will also raise Local Housing Allowance rates in Great Britain to the 30th percentile of local market rents in April 2024. 1.6 million low-income households will be better off, gaining £800 on average in 2024-25. [footnote 96]

To support low-income households to build savings, the government is also reforming the Help to Save scheme, which aims to encourage low-income workers to save for short-term and long-term term goals and kickstart a lifelong savings habit, through adding a bonus to savings. The new design will ensure the scheme’s sustainability as a key savings product, encourage take-up and provide the best value for taxpayers. The new design will be published in due course, alongside the launch of a consultation on the most effective way to deliver it.

The government will also increase working age benefits delivered by DWP in Great Britain and by HM Revenue and Customs across the United Kingdom by 6.7% next year, equivalent to inflation in the 12 months to September 2023, which is the typical basis for benefit uprating and is higher than the OBR’s forecasts for earnings and inflation next year. [footnote 97] This will see 5.5 million households on Universal Credit gaining £470 on average in 2024-25, in addition to the government’s other cost of living support. [footnote 98]

The government is supporting pensioner incomes by maintaining the Triple Lock. The basic State Pension, new State Pension and Pension Credit standard minimum guarantee will be uprated in April 2024 in line with average earnings growth of 8.5% in the reference period. [footnote 99] This means that the new State Pension will be worth up to £900 a year more. [footnote 100]

Taken together, support to households to help with cost of living pressures is worth £104 billion over 2022-23 to 2024-25, or £3,700 per household on average. [footnote 101]

Backing British Business

Growing the economy without fuelling inflation.

The government is focussed on long-term decisions to strengthen the economy. The government recognises that growth cannot be generated through directing economic activity – it comes from giving individuals the freedom to learn, innovate and succeed. The job of government is to create the right conditions for the private sector to thrive. In light of challenging fiscal conditions, the government must be smarter and more strategic – this means prioritising the UK’s strengths and being focussed on the biggest opportunities for growth.

The government supported households and businesses through historic shocks. This year, GDP growth has been more resilient than forecast in the spring and was faster than Germany, Italy and the euro area as a whole. [footnote 102] Revisions to the National Accounts mean that the level of GDP is higher than previously thought. [footnote 103] GDP growth has slowed into the second half of 2023 as higher interest rates contributed to a fall in household consumption. [footnote 104] Responsible policy choices at Autumn Statement support lower taxes and long-term, sustainable growth, whilst supporting the Bank of England in reducing inflation. The Office for Budget Responsibility (OBR) forecast shows that, compared to Spring Budget 2023, borrowing is lower on average across the forecast and debt as a proportion of GDP is lower in every year. [footnote 105]

At Spring Budget 2023, and in successive announcements since, the Chancellor has set out the government’s plan to deliver sustained economic growth. The Autumn Statement goes further, tackling long-term barriers to investment, cutting taxes and rewarding work. The policies set out in Box 4.A, taken together, could raise business investment by around £20 billion per year in a decade’s time.

• To unlock business investment the government will make full expensing permanent , building on the UK’s already competitive business tax regime and making sure the UK has one of the most generous capital allowances regimes in the world.
• To get Great Britain building and to deliver energy security and the net zero transition, the government will remove barriers to investment in critical infrastructure by reforming the UK’s inefficient planning system and speeding up electricity grid connection times .
• To ensure that the UK’s world-leading financial system invests the capital companies need to grow, the government is bringing forward a comprehensive package of pension reform and driving private investment from insurers into infrastructure by legislating for key reforms to Solvency II .
• To ensure the door is held wide open to those that want to invest in the UK’s future, the government is taking steps to boost foreign direct investment, through supporting the Office for Investment to strengthen its concierge offer to strategically important investors.
• To help create the conditions for innovative and dynamic businesses to thrive, the government is bringing forward an ambitious package to supercharge small and medium sized enterprises as the engine room of the economy.
• To unlock investment, support levelling up and enable the UK to seize growth opportunities through the transition to net zero, the government is making £4.5 billion available in strategic manufacturing sectors – auto, aerospace, life sciences and clean energy – from 2025 for five years.
• To support a thriving economy, the government will deliver a world-class education system to ensure employers have access to a strong, dynamic and highly skilled workforce that meets industry needs.
• Lastly to ensure the benefits of its growth package are felt everywhere, the government is announcing new Investment Zones and plans for deepening and extending devolution to boost investment and deliver on the government’s commitment to levelling up.

Unlocking business investment

Relatively low business investment compared to other advanced economies has been part of the UK’s historically weak productivity performance. UK business investment has been 9.5% of nominal GDP over the last 10 years, compared to 11.2% on average in France, Germany and the US. [footnote 106] This has fed into the UK’s productivity weakness with lower capital stock per hour worked accounting for most of the productivity gap to France and around half that to Germany. [footnote 107]

There is no single driver of the UK’s business investment gap. The government’s strategy is centred on removing barriers, providing the right incentives and expanding access to capital in order to increase levels of investment. Government action is already having an impact – although the data can be volatile and revised – since Q2 2021, when the super deduction was launched, investment growth has been faster in the UK than any other country in the G7. [footnote 108]

Chart 4.1: Decomposition of the UK’s output per hour worked gap with selected economies, 2019

Source: HM Treasury estimates using GDP and GDP per hour worked at current prices and adjusted for purchasing power parity from OECD’s data warehouse. Calculations also use Penn World Tables (version 10.01) data on capital services at current purchasing power parities, index of human capital per person, and the share of labour compensation in GDP.

Box 4.A Business investment package effects

The Autumn Statement announces a range of measures to grow the supply-side of the economy by supporting increased business investment. As the Office for Budget Responsibility set out in the Economic and fiscal outlook, full expensing is expected to raise business investment and potential output within the five-year economic forecast, and other measures could boost business investment over the longer term. [footnote 109] This box sets out some of these longer‑term effects.

Policies and their economic effects

Permanent full expensing reduces firms’ cost of capital for qualifying plant and machinery investment. This raises the economy’s long run optimal capital stock, which in turn increases annual business investment. The OBR expect the policy to increase business investment by £3 billion per year.

Pension reforms, as described below, have the potential to make more pension scheme funding available to finance business investment. This could result in an additional £75 billion of financing for unlisted equity investment. Some of this would flow overseas or to secondary investments. But this additional finance could also address the current mismatch between the supply and demand for equity finance by smaller firms in the UK (an “equity gap”), thereby raising business investment. [footnote 110] The insurance industry may similarly increase investment in productive assets due to reform to Solvency II. [footnote 111] Taken together, these reforms could support an increase in business investment of around £2 billion per year in the long run.

The government is also targeting public funding within the manufacturing sector to help unlock private investment in eight strategic sectors. The targeted funding will support opportunities to develop and build the UK’s current or future economic strengths and enable UK industries to remain at the forefront of the global transition to net zero. This funding could support an average of £2 billion of additional business investment per year in UK manufacturing for 10 years. [footnote 112]

Several of the measures, for example reforms to upgrade the electricity transmission network, are intended to remove barriers to investment, as discussed below, and could therefore result in investment being brought forward. Analysis published by Department for Energy Security and Net Zero (DESNZ) and reviewed by the Energy Systems Catapult estimates that, once embedded, the grid reforms announced could increase investment temporarily by an average of £10 billion per year over the next ten years, speeding up the transition to net zero. [footnote 113] Alongside reforms to planning and the electricity grid, as part of the ongoing Price Review process led by Ofwat and based on submitted draft plans, water companies could increase investment by £6 billion per year compared to the previous price review period. [footnote 114]

Taken together, the policy measures set out above will build over time so that they could raise business investment by around £20 billion per year in a decade’s time.

There are uncertainties around the estimated aggregate impact. Any sustained, additional business investment on this scale would need to be met via an increase in domestic or foreign savings. Other government policy measures have the potential to help facilitate this – notably, the packages announced at Spring Budget and in the Autumn Statement that together add nearly 200,000 people to employment. [footnote 115] A positive labour supply boost such as this can raise aggregate income and national savings, facilitating higher business investment. [footnote 116] The existence of this channel can therefore increase confidence in the estimates presented here.

Setting out the UK’s world class business tax and investment offer

The UK already has one of the most competitive business tax regimes among major economies, with the lowest headline rate of Corporation Tax and joint highest uncapped headline rate of R&D tax relief for large companies in the G7. [footnote 117] [footnote 118]

Chart 4.2: Headline Corporation Tax rate, G7 countries, 2023

Source: OECD Tax Database, rate takes into account surcharges and sub-national rates

At Spring Budget 2023 the government went further by introducing full expensing for three years from 1 April 2023 – a £27 billion Corporation Tax cut for companies investing in the UK – and undertook to make this tax cut permanent when fiscal conditions allowed.

The government is honouring this now, by making full expensing permanent. This reflects the government’s commitment to support businesses to invest, as well as to ensure the tax system is simple, stable and predictable.

Companies across the UK will be able to write off (“fully expense”) the full cost of qualifying main rate plant and machinery investment in the year of investment, supporting businesses to invest and grow. This means companies are rewarded with up to 25p off their tax bill for every £1 that they invest, which amounts to a tax cut of over £10 billion per year. [footnote 119]

This significant reform makes the UK’s capital allowances regime one of the most generous in the world, and it boosts the UK to joint first among OECD countries in net present value terms. The UK’s low and internationally competitive Corporation Tax rate, combined with some of the world’s most generous investment incentives, will ensure the tax system encourages investment.

Chart 4.3: Net present value of plant and machinery capital allowances, 2022 OECD regimes

*The US, Canada and Chile are in the process of phasing out their temporary full expensing policies for plant and machinery capital allowances since the data in this chart was published, which mean that NPVs are now expected to be lower.

Source: HMRC analysis using OECD 2022 data from Tax Foundation 2023 cost of capital recovery publication.

Full expensing has long-term and wide-reaching economic benefits, reducing the cost of capital for firms and boosting overall business investment by £3 billion a year according to the OBR. [footnote 120] The additional investment increases GDP by 0.1% by the end of the forecast period, increasing further to slightly below 0.2% in the long run. [footnote 121] The government has prioritised this business tax cut as it is the most effective tax measure to prioritise growth across all sectors of the economy, rewarding those that invest the most with lower taxes.

Permanent full expensing, including the 50% first-year allowance for special rate assets, will give companies certainty to plan long-term investments. This applies across the economy, including to the UK’s capital intensive green industries such as solar and offshore wind, which will also benefit from a new investment exemption from the Electricity Generator Levy. Permanent full expensing also provides further support for companies that want to decarbonise by investing in solar panels and heat pumps, and for companies that want to invest in newer, greener plant and machinery.

The cash flow benefits of full expensing are particularly important in a high interest rate environment when companies are facing higher costs, since cash up front has become even more valuable than a stream of future lower payments through Writing Down Allowances. Given that costs of the policy are much lower in the long-term, the government sees full expensing as an effective and targeted way of using the government’s balance sheet to increase investment in a fiscally sustainable way.

The move to full expensing also provides us with an opportunity to permanently simplify capital allowances. The government will therefore launch a technical consultation on wider changes to simplify the UK’s capital allowances legislation.

Since Spring Budget, the government has been exploring the case for expanding the scope of full expensing to include assets for leasing with an industry working group. The government will continue to carefully consider whether there is a case to do so and publish a technical consultation in due course to seek further input from a wider range of stakeholders.

The government is committed to protecting and enhancing the UK’s energy security and maintaining competitiveness. In recognition of this, alongside confirming the Energy Profits Levy will end no later than 31 March 2028, the government has published the conclusion to the review of the oil and gas fiscal regime and set out the final design of the Energy Security Investment Mechanism, including future adjustments to the mechanism’s price thresholds in response to inflation. This package will provide certainty and predictability for investors and operators in this crucial industry in the short-, medium- and long-term.

The government is committed to supporting businesses with business rates bills. Many larger retail businesses and large supermarkets benefitted from the 2023 business rates revaluation and the £13.6 billion package of support provided at Autumn Budget 2022, which together decreased total bills paid by the retail sector by an estimated 20% and large supermarkets by an estimated 15%. [footnote 122] A third of properties in England have already been taken out of rates completely through Small Business Rates Relief, and the government has also frozen the tax rate for the last three years, extended the relief for Retail, Hospitality and Leisure (RHL) properties and removed downwards caps from Transitional Relief. [footnote 123]

The government will continue to make sure that support is offered to the small businesses, high street shops and independent cafes and pubs that need it most. The small business multiplier will be frozen for another year, while the 75% RHL relief will be extended for 2024-25. The standard multiplier will be uprated in line with September’s CPI. These changes will take effect from 1 April 2024 in England. English Local Authorities will be fully compensated for the loss of income as a result of these business rates measures and will receive new burdens funding for administrative and IT costs.

The government has chosen to prioritise measures that will boost investment and growth, while not fuelling inflation. While this means that business rates bills will go up for some, these increases will be far outweighed by the benefits of full expensing for companies that invest. For example, HM Treasury estimates that while inflation uprating of the multiplier will result in an increase of £250 million or 6.4% in business rates paid by the retail sector in 2024-25, the sector could benefit from full expensing by around £1 billion per year. [footnote 124] In addition, total bills paid by larger retail businesses and supermarkets will still be lower in 2024-25 than they were before the 2023 revaluation.

The Government is committed to internationally competitive R&D tax reliefs. Following consultation, the current R&D Expenditure Credit (RDEC) and SME schemes will be merged from April 2024 onwards, simplifying the system and providing greater support for UK companies to drive innovation. The rate at which loss-making companies are taxed within the merged scheme will be reduced from 25% to 19%. The intensity threshold in the R&D intensives scheme will also be reduced from 40% to 30% for accounting periods that start on or after 1 April 2024, allowing around 5,000 extra SMEs to qualify for an enhanced rate of relief. [footnote 125] A one year grace period will also be introduced, providing certainty for companies who dip under the 30% threshold that they will continue to receive relief for one year. Taken together, these changes will provide £280 million of additional relief per year by 2028-29 to help drive innovation in the UK.

Removing barriers to investment and supporting infrastructure

Delivering high quality infrastructure is crucial for boosting economic growth and productivity across the UK, and is an essential foundation for increasing energy security and transitioning to net zero. This means addressing barriers to investment such as the UK’s outdated planning system and lengthy delays to connect to the electricity grid; and making the economic regulatory framework more pro-investment.

Reforming the UK’s planning system is crucial to ensuring there is investment in the essential infrastructure and commercial development needed for growth. The government will progress the National Infrastructure Commission’s (NIC) April recommendations on planning by delivering reforms to return the Nationally Significant Infrastructure Project regime to the two and a half year average consenting time achieved in 2012. [footnote 126] [footnote 127] As set out in ‘Getting Great Britain building again: speeding up infrastructure delivery’ policy paper, the government’s active reform agenda to deliver this ambition includes publishing spatial data on major infrastructure projects for the first time and ensuring a more reliable process for updating National Policy Statements, further to the updates to the National Networks and Energy National Policy Statements that will be designated in the coming months. [footnote 128]

Alongside reforms to deliver infrastructure quicker, the government will strengthen the capacity of the planning system to deliver a better service for businesses, including introducing new premium planning services across England with guaranteed accelerated decision dates for major applications and fee refunds wherever these are not met. These services will improve the existing patchwork approach of Planning Performance Agreements. The government will also invest £5 million to incentivise greater use of Local Development Orders in England, to end delays for businesses so that key commercial projects secure planning permission faster.

The government is also creating more certainty for investors in low-carbon infrastructure by extending the critical national priority designation for nationally significant low-carbon energy projects. Alongside this, the government will look to remove unnecessary planning constraints by accelerating the expansion of electric vehicle (EV) charging infrastructure and will consult on amending the National Planning Policy Framework to ensure the planning system prioritises the rollout of EV chargepoints, including EV charging hubs. It will also consult on introducing new permitted development rights to end the blanket restriction on heat pumps one metre from a property boundary in England. Together these measures will reduce delays and capitalise on the UK’s world-leading approach to decarbonising the economy.

Substantive action is required to address the lengthy wait to connect to the electricity grid. These delays limit investment in the transition to low-carbon power generation, which is critical to the UK’s energy security. The government is therefore announcing reform of the grid connection process to cut waiting times, including freeing up over 100GW of capacity so that projects can connect sooner. This will help to enable the significant majority of projects to get their requested connection date with no wait and, for viable projects, reduce overall connection delays from five years to no more than six months. [footnote 129]

The government is also setting out an Action Plan to halve the time to build new grid infrastructure to seven years, in response to the review by the Electricity Network Commissioner, Nick Winser. Key elements of this action plan include new proposals for community benefits with up to £10,000 off electricity bills; consulting next year on reforms to energy consenting rules in Scotland; committing to commission the Electricity System Operator to work with government to produce a new Strategic Spatial Energy Plan; and introducing competition into onshore electricity networks in 2024 to benefit consumers. These actions will support the government’s efforts to electrify and decarbonise the economy and increase the UK’s energy security. Overall, these actions will help to lower electricity prices and are estimated to deliver a net saving of £15-25 on average per household per year out to 2035. [footnote 130]

The Autumn Statement addresses several of the NIC’s recommendations, published in October in its second National Infrastructure Assessment (NIA2). [footnote 131] The government will respond in full to the NIA2 with an updated National Infrastructure Strategy next year.

The government continues to make the most of its Brexit freedoms to make the UK’s globally respected regulatory regime even more pro-growth and pro‑investment without compromising on its quality and effectiveness. In addition to consulting on the economic regulation framework to encourage greater private investment through proposals to increase competition for strategic infrastructure investment and develop a long-term investment blueprint, the government is also consulting on stronger guidance on the regulators’ Growth Duty; extending the Growth Duty to Ofgem, Ofwat and Ofcom; and providing a new strategic steer for the Competition and Markets Authority. [footnote 132] [footnote 133] This will ensure the UK’s regulators must be pro-innovation, agile facilitators of growth in the sectors they regulate. The government will kickstart a Smart Data Big Bang, giving industry and investor certainty by setting out the UK’s ambition for using new powers in the Data Protection and Digital Information Bill, exploring innovative opportunities across seven sectors: energy, banking, finance, retail, transport, homebuying and telecoms.

The government welcomes the Financial Reporting Council’s (FRC) renewed focus on ensuring the UK’s corporate governance and stewardship regime supports growth and enhances the UK’s international competitiveness. Reflecting the importance of this work, the government has updated the FRC’s remit. The revised remit emphasises the important role the FRC should play in promoting the competitiveness and growth of the UK economy whilst fulfilling its core purpose of enhancing public trust and confidence in corporate governance. [footnote 134]

Recognising the need to better support the critical links between and within towns and cities, the government recently made the decision to not extend HS2 beyond Birmingham, and to take a radically new, development-led approach at Euston station, which will leverage significant private finance. The government’s decisions on HS2 will deliver £36 billion of savings that will be reallocated to Network North, an ambitious pipeline of alternative transport projects which will drive growth and connectivity in the great towns and cities across the North. [footnote 135] This will expand Northern Powerhouse Rail, allocate an extra £8.3 billion to roads resurfacing across England; deliver the long-promised mass transit system in West Yorkshire; and provide £8.55 billion of additional funding for the second round of City Region Sustainable Transport Settlements (CRSTS2).

Unlocking investment in growth through the financial system, pension funds, and international investment offer

The government has announced a comprehensive package of pension reform that will provide better outcomes for savers, drive a more consolidated pensions market and enable pension funds to invest in a diverse portfolio. These measures represent the next steps of the Chancellor’s Mansion House reforms and meet the three golden rules: to secure the best possible outcomes for pension savers; to prioritise a strong and diversified gilt market; and to strengthen the UK’s competitive position as a leading financial centre. [footnote 136] This package builds on the momentum from industry over the summer which has seen further signatories join the Mansion House Compact taking the total number to 11, the launch of the British Venture Capital Association’s Venture Capital Investment Compact and the Mansion House Pension Summit bringing together pension funds, trustees and private market investors for the first time.

Large schemes can drive down costs for savers and are better placed to diversify into growth equity. [footnote 137] Therefore the government welcomes the current trend of defined contribution pension fund consolidation and expects to see a market in which the vast majority of savers belong to schemes of £30 billion or larger by 2030. [footnote 138] The Financial Conduct Authority (FCA) will consult next spring on the next steps of the new Value for Money Framework. As part of this, schemes will be required to compare themselves against others in the market, including large scale schemes, to ensure they are delivering value for their members.

The government will tackle the long-standing problem of “small pot” pensions and is launching a call for evidence on a lifetime provider model which would allow individuals to have contributions paid into their existing pension scheme when they change employer, providing greater agency and control over their pension.

To increase opportunities for defined benefit schemes to invest in productive finance while fully protecting member benefits, the government will consult this winter on how the Pension Protection Fund can act as a consolidator for schemes unattractive to commercial providers and whether changes to rules around when surpluses can be repaid, including new mechanisms to protect members, could incentivise investment by well-funded schemes in assets with higher returns. The authorised surplus repayment charge will also be reduced from 35% to 25% from 6 April 2024.

Following consultation, the government confirms that guidance for the Local Government Pension Scheme (LGPS) in England and Wales will be revised to implement a 10% allocation ambition for investments in private equity, which is estimated to unlock around £30 billion. [footnote 139] The government is also establishing a March 2025 deadline for the accelerated consolidation of LGPS assets into pools and setting a direction towards fewer pools exceeding £50 billion of assets under management.

To support pension scheme investment into the UK’s most innovative companies, the government will commit £250 million to two successful bidders in the Long-term Investment for Technology and Science (LIFTS) initiative, subject to final agreement. This will create new investment vehicles tailored to the needs of pension funds, generating over a billion pounds of investment from pension funds and other sources into UK science and technology companies.

Following positive feedback from industry, the government is confirming its intention to establish a Growth Fund within the British Business Bank (BBB). The Growth Fund will draw upon the BBB’s expertise and a permanent capital base of over £7 billion to give pension funds access to investment opportunities in the UK’s most promising businesses. A new Venture Capital Fellowship will help produce the next generation of world-leading investors in the UK’s renowned venture capital funds to support investment into the UK’s most innovative high-growth companies.

Alongside measures on pensions investment, the government is legislating to give effect to the Solvency II reforms to deliver a more tailored, clearer and simpler regulatory regime for the insurance sector. The reforms will boost economic growth by incentivising private investment for productive assets, such as infrastructure. Industry have committed to investing over £100 billion in a greater range of productive assets over the next decade as a result of the Solvency II reforms. [footnote 140]

The government is committed to ensuring that the UK is the most attractive destination in Europe for internationally mobile investment. To that end, the Chancellor and the Secretary of State for Business and Trade asked Lord Harrington in March 2023 to review the government’s approach to attracting foreign direct investment.

Lord Harrington’s Review has been published alongside the Autumn Statement. [footnote 141] The government has responded and accepted in principle his headline recommendations. [footnote 142] A new Ministerial Investment Group will be established, tasked with driving the government’s ambition on investment. This will be backed by additional resource and an improved toolkit for the Office for Investment, allowing it to deepen its world-class concierge offer to strategically important investors.

Supporting the growth of the UK’s world-leading financial services sector

The UK’s world-leading financial and related professional services sector is a vital source of UK growth. It makes up an estimated 12% of the economy, contributes around £100 billion a year in tax receipts and employs 2.5 million people across the country. [footnote 143] The government is taking important steps to build on these strengths – setting the UK up for another century of success as the global capital for capital – to grow the sector and the economy.

Ensuring UK companies have access to capital and supporting the UK’s world-leading capital markets is critical for future growth. The government’s comprehensive package of ongoing regulatory reforms includes Lord Hill’s Listings Review, Mark Austin’s Secondary Capital Raising Review, Rachel Kent’s Investment Research Review and the Wholesale Markets Review. [footnote 144] The government is now delivering Lord Hill’s central recommendation, laying legislation to fundamentally overhaul the UK’s prospectus regime. In addition, the government is putting in place a consolidated tape to improve market data; launching a financial market infrastructure sandbox to test distributed ledger technology; and making fundamental changes to short selling. Finally, the FCA and government are also engaging industry stakeholders to take forward the recommendations of the Investment Research Review.

Following the passage of the Financial Services and Markets Act 2023 in July, the government continues to take steps to ensure the UK maintains and enhances its world-leading financial services regulatory environment. The government repealed over 100 pieces of unnecessary retained EU law earlier this year. [footnote 145] As part of the Edinburgh Reforms, the government committed to making significant progress in building a Smarter Regulatory Framework tailored to the UK by the end of the year. The government is delivering on this promise by soon laying key legislation, and publishing drafts of other legislation being progressed. Given the global interconnectedness of the financial system, the government also continues to work closely with its international partners through the Financial Stability Board and other fora to establish and maintain high global standards and to mitigate risks to financial stability.

The government is also committed to growing the UK’s world-leading retail payments sector. That is why the government supports Joe Garner’s independent review into the future of payments. [footnote 146] The government is acting to implement the review’s core recommendations, including repealing prescriptive EU-derived payments authentication rules allowing industry to better prevent fraud and improve the customer payments experience. The FCA will review the rules with a view to adopting an outcomes-based approach, and will specifically consider the contactless limits.

The government is also committed to unlocking the full potential of Open Banking-enabled payments and will seek to legislate next year to support this. The government’s intention is for the new regulatory framework to require firms beyond the largest banks to participate in a sustainable and equitable commercial model through which the technology and necessary consumer protections will be developed, and with appropriate regulatory backstops. In line with the Review’s central recommendation, the government will publish a National Payments Vision next year. Building from the review’s findings, this will include consideration of priorities for UK payments and, working with the Payment Systems Regulator and the Bank of England, will consider the role of the New Payments Architecture.

The government is committed to exiting its shareholding in NatWest, subject to market conditions and sales representing value for money. The government intends to fully exit by 2025-26 utilising a range of disposal methods, including accelerated bookbuilds and directed buybacks with NatWest and also via continuing sales through the ongoing trading plan. As part of the plan to return NatWest to the private sector, the government will explore options to launch a share sale to retail investors in the next 12 months, subject to supportive market conditions and achieving value for money.

The government is making changes to simplify ISAs and provide more choice, meaning it will be easier for people to choose the best ISA accounts for their needs and move money between them. This involves digitalising the ISA reporting system to make it more effective, as well as expanding the investment opportunities available in ISAs to include Long-Term Asset Funds and open-ended property funds with extended notice periods.

Fostering a dynamic and innovative investment economy

Supporting the uk’s scientists and innovators.

Scientific breakthroughs are a crucial driver of long-run growth and play a critical role in improving lives and helping to tackle societal challenges. The UK hosts many of the world’s leading universities and the government provides the most generous support for business R&D in the OECD as a share of GDP through tax relief and public investment. [footnote 147] The government is now going even further to ensure the UK remains at the cutting edge of science, innovation and technological development.

The Prime Minister has negotiated excellent terms for the UK to associate to Horizon Europe and Copernicus, getting great value for taxpayers while maximising opportunities for researchers. As a result, the government can now announce ambitious investments of over £750 million in UK R&D this financial year. These investments include transformative new programmes, including £250 million for long-term world-class Discovery Fellowships, £145 million for new business innovation support, and support to establish a National Academy focussed on mathematical sciences. The government is also ensuring the research, development and innovation organisational landscape is diverse, resilient, and investable, in response to Sir Paul Nurse’s review. [footnote 148] The government will also continue to cut bureaucracy in grant applications.

University spin-outs are some of the UK’s most innovative companies and play a hugely important role for the UK economy, with investment increasing almost five-fold since 2014. [footnote 149] To capitalise on this strength, the government is accepting all the recommendations of the Independent Review of Spin-outs and setting out how it will deliver them. [footnote 150] Several universities and investors have already endorsed the recommendations of the review, and the government will provide £20 million for a new cross-disciplinary proof-of-concept research funding scheme, to help prospective founders in the UK’s universities demonstrate the commercial potential of their research.

The government is committed to staying at the forefront of new technology. For example, this Autumn Statement provides £121 million for the UK’s space sector. This investment will pave the way for new space clusters and infrastructure, make progress towards the government’s climate goals by supporting the earth observation industry and deliver new capabilities in low earth orbit satellite communications technology. The government is also building on the £2.5 billion ten-year National Quantum Strategy by publishing an ambitious set of quantum missions, [footnote 151] including a mission to have accessible, UK-based quantum computers capable of running 1 trillion operations by 2035. Other missions focus on quantum networks, medical applications, navigation, and sensors for infrastructure.

The government also remains committed to ensuring early-stage, innovative companies have access to the investment they need to grow and develop. To continue supporting thousands of start-ups and small and medium-sized enterprises (SME) each year who face the biggest challenges in accessing growth capital, the government will legislate to extend the Enterprise Investment Scheme (EIS) and Venture Capital Trusts (VCT) to 2035.

To support these innovative businesses to accelerate their growth and scale up, the government is extending the British Business Bank’s Future Fund: Breakthrough programme. This will provide at least £50 million additional investment in the UK’s most promising R&D intensive companies.

It is vital that businesses can access the talent they need, which is why the government is delivering on the Spring Budget 2023 commitment to simplify and expand the UK’s business visitor visa. The includes introducing changes from January 2024 that will broaden and clarify the activities that can be undertaken in an intra-corporate setting, offer wider coverage for the legal services sector and simplify arrangements for those undertaking paid engagements. During 2024 the government will explore further improvements to the business visitor rules alongside the potential for further enhanced provisions linked to trade negotiations. Given these changes relate to short-term business visas, they do not impact on the overall level of net migration. The government is also signing and expanding new and existing Youth Mobility Schemes (YMS) to make sure the next generation of talent have a wide range of opportunities to live, work and travel abroad and experience other cultures. This year the government has increased the places available on the YMS with Australia and Canada by 7,000 and, for 2024, added a further 9,100 places through new and expanded agreements, including with Japan and South Korea. [footnote 152] In 2023 the government has also expanded the eligibility and length of stay available for participants from Canada, New Zealand and Australia.

Supercharging growth of the UK’s SMEs

The vast majority of businesses in the UK are SMEs and they are engines of the economy. [footnote 153] The UK has a reputation as a world-leading location for businesses to start up and grow and the Autumn Statement builds on this. [footnote 154] In addition to freezing the small business rates multiplier in England, the government is announcing a package of support to help SMEs thrive.

One of the key challenges facing SMEs is the cash-flow implications of late payments, which hold small businesses back from investing and innovating. Alongside publication of the Payment & Cash Flow Review Report and action taken through the Procurement Act, the government will lead by example in introducing more stringent payment time requirements for firms bidding for large government contracts. From April 2024, firms bidding for government contracts over £5 million will have to demonstrate they pay their own invoices within an average of 55 days, tightening to 45 days in April 2025, and to 30 days in the coming years.

In order for SME leaders to acquire the vital skills and opportunities they need to increase productivity and grow their businesses, the government is expanding the Made Smarter Adoption, programme helping more manufacturing SMEs use advanced digital technologies. The government is also setting up a taskforce to rapidly explore how best to support SMEs to adopt digital technology, committing to delivery of the Help to Grow: Management programme beyond 2024-25; and offering additional support to SMEs to access global markets through UK Export Finance.

To reward work, and so that the self-employed are able to keep more of their hard-earned money, the government will cut and simplify self-employed taxes from 6 April 2024. The main rate of Class 4 self-employed NICs will be cut from 9% to 8%, and the outdated and needlessly complicated Class 2 self-employed NICs will be abolished. Together these cuts will benefit around 2 million self‑employed people and the average self-employed individual on £28,200 will see a saving of £350 in 2024-25.

The government is also announcing that HMRC will rewrite guidance around the tax deductibility of training costs for sole traders and the self-employed, to provide more clarity to business on what costs are deductible. This will ensure that individuals can be confident that updating existing skills, or maintaining pace with technological advances or changes in industry practices, are allowable costs for tax purposes.

Investing in energy security and net zero

Delivering the net zero transition is vital to the UK’s energy security and long-term prosperity. In Powering Up Britain [footnote 155] the government laid out clear and comprehensive plans to meet its energy security and climate targets. As the Prime Minister has stressed, the government will deliver these in a proportionate and pragmatic way, which protects households and plays to the UK’s significant strengths.

The government is therefore focused on securing the investment needed to deliver clean energy and support industry to decarbonise. This approach has already mobilised £198 billion of public and private investment in low-carbon energy since 2010, and seen the UK decarbonise faster than any other G7 country since 1990. [footnote 156] [footnote 157] The cross-economy measures in the Autumn Statement will unlock further investment in the transition in the years ahead.

The UK Emissions Trading Scheme (ETS) plays a vital role in providing businesses with the long-term certainty to plan ahead and decarbonise efficiently. Reforms to the ETS, as set out by the UK ETS Authority in July 2023, will reduce the number of ETS permits available for purchase from government by 45% between 2023 and 2027. It will also extend the scheme to cover emissions from domestic maritime and energy from waste in 2026 and 2028 respectively. This is an important step in achieving net zero ambitions.

In a connected world, the ETS can only be truly effective if action is taken to mitigate the risk of carbon leakage. The government has undertaken extensive consultation on possible measures to mitigate carbon leakage risk including introducing a carbon border adjustment mechanism and will publish its response shortly.

The government is providing support to help firms transition to a resilient, low-carbon and industrially competitive future. This includes spending £185 million on the Industrial Energy Transformation Fund (IETF) to support industrial sites invest in more energy efficient and low-carbon technologies. This grant funding will come from the £6 billion announced at Autumn Statement 2022 to support energy efficiency from 2025, with further allocations set out in due course. The government is also providing around £300 million a year in tax relief in exchange for meeting energy efficiency targets under the new six-year Climate Change Agreement scheme which starts from 2025, and expanding VAT relief available on the installation of energy-saving materials in residential buildings or those used solely for a relevant charitable purpose.

To support continued investment in the UK’s renewable generation capacity, the government will legislate for a new investment exemption for the Electricity Generator Levy (EGL). New projects for which the substantive decision to proceed is made on or after 22 November 2023 will be exempt from the EGL. The government has published a technical note on the exemption and will legislate in an upcoming Finance Bill. The EGL will end as planned on 31 March 2028. The government has also set out the parameters for the next renewables Contracts for Difference auction round, increasing the maximum price that can be received, and will shortly publish further details on growing hydrogen and Carbon Capture, Usage and Storage (CCUS) deployment, ensuring that the government’s world-leading clean energy deployment continues at pace and remains on track to meet the government’s energy security and net zero ambitions.

To further accelerate the UK’s world-leading offshore wind deployment, the government will bring forward legislation to provide the Crown Estate with borrowing and wider investment powers as soon as parliamentary time allows, which will help to unlock a further 20-30GW of new offshore wind seabed rights by 2030. Government is working with The Crown Estate to bring forward additional floating wind in the Celtic Sea through the 2030s, which could see an additional 12GW of generation deployed, alongside the 4.5GW round due to open soon, with the potential to deliver £20 billion of direct investment from deployment in the area. [footnote 158]

Catalysing the growth sectors of the future

At Spring Budget and throughout 2023, the Chancellor has unveiled a package of measures to turbocharge growth in the industries of the future. The Autumn Statement builds on this with further steps to make sure the UK is investing in its strengths and developing its competitive advantage in these sectors.

Advanced Manufacturing

The manufacturing sector is a vital part of the UK’s economy. It enables levelling up across the country, helps deliver net zero commitments and promotes economic security and resilience. The sector contributes 41% of all UK expenditure on business R&D, 43% of exports, and provides around 2.6 million jobs. [footnote 159] [footnote 160] [footnote 161] These jobs are often highly skilled, are typically located in UK regions with lower gross disposable household income and pay 9% more than the national average. [footnote 162] [footnote 163]

The UK also has a world-leading track record of delivery on decarbonisation, with significant steps taken to strengthen energy security and the broader investment environment. This approach has seen £198 billion of public and private investment into low carbon sectors since 2010. Therefore, the UK will not be looking to match countries such as the US pound for pound on the back of policies like the Inflation Reduction Act.

The UK will take a different approach, continuing to build a positive environment for investment via cross-cutting measures such as full expensing, supported by targeted funding where justified to bolster the UK’s attractiveness as a place to start, grow and invest in manufacturing businesses.

Funding of £4.5 billion has been announced to help unlock private investment in strategic manufacturing sectors, starting in 2025-26 and lasting for five years. Over £2 billion is being made available for the automotive sector to support the manufacturing and development of zero emission vehicles, their batteries and supply chain. £975 million is being made available for the aerospace sector to support the development of energy efficient and zero-carbon aircraft technology. £520 million is being made available for life sciences to build resilience for future health emergencies and capitalise on the UK’s R&D strengths. And £960 million is being made available for green industries to support strong clean energy manufacturing capacity across the UK and seize opportunities from the global net zero transition.

Advanced manufacturing harnesses the UK’s world-leading R&D capabilities and the government is taking further steps to support innovation across the wider sector. The government recently published Dame Angela McLean’s review of the role that regulation can play in driving innovation and growth in advanced manufacturing, alongside the government’s response accepting all recommendations. [footnote 164] The government also published its Critical Minerals Strategy refresh earlier this year and recently committed to extend the Connected and Automated Mobility R&D programme. [footnote 165]

The government is also unlocking new sources of finance for advanced manufacturing. The Chancellor has recently clarified the government’s priorities for the UK Infrastructure Bank to ensure the Bank is able to invest in critical supply chains where it meets the Bank’s strategic objectives, including semiconductor manufacturing and critical minerals. The Bank is actively engaging with the relevant sectors and exploring opportunities in these markets.

Other announcements being taken forward by the government at Autumn Statement which support UK advanced manufacturing firms include expanding the Made Smarter Adoption programme, responding to Lord Harrington’s review of foreign direct investments, championing apprenticeship provision through the growth sectors apprenticeship pilot and providing details of further Investment Zones focused on the sector. The government will shortly set out more on its actions to support investment and growth in the manufacturing sector with the publication of the Advanced Manufacturing Plan and UK Battery Strategy.

Green industries

This Autumn Statement will boost investment to support the government’s clear plans to deliver net zero and energy security objectives. UK firms are ready to supply vital goods and services to the new global green economy, maximising growth opportunities through the transition.

The UK is already seizing the opportunities and exports within low-carbon and renewable energy industries, which are growing significantly faster than exports from the broader economy. [footnote 166] Not only is the UK a world leader in the deployment of offshore wind, but its industries are also driving the development of innovative Small Modular Nuclear Reactors (SMRs) and investing in the UK’s potential to store an estimated 78 billion tonnes of carbon in the UK continental shelf. [footnote 167]

To ensure the UK continues to build strong supply chains and maximises global growth opportunities, the government is announcing a £960 million Green Industries Growth Accelerator (GIGA). This will support investments in manufacturing capabilities for the clean energy sectors where the UK can gain the clearest strengths: Carbon Capture Utilisation and Storage (CCUS), hydrogen, offshore wind, electricity networks, and nuclear. GIGA will enable the UK to seize growth opportunities through the transition to net zero, unlocking private investment, protecting jobs and creating new ones, and leveraging impact across the wider supply chain. The fund will sit alongside the full range of long-term deployment support set out in Powering Up Britain which will ensure the government delivers the clean energy transition and boosts green investment and job creation across the country.

Digital technology and AI

Digital technologies have radically transformed lives, from smart phones and apps to the internet of things. The UK is harnessing the significant growth potential of digital technologies to continue as the leading European tech ecosystem, which last year was worth more than double Germany’s and three times as much as France’s, and contributed GVA of £158 billion. [footnote 168] Not only does this represent 3 million jobs and 85,000 tech start-ups, [footnote 169] including ground-breaking companies such as DeepMind, but the UK is also taking a world-leading role in developing technologies of the future, like Artificial Intelligence (AI) and quantum computing, ensuring that the UK is at the forefront of shaping how technology transforms lives for the better.

The development of AI has accelerated over the last year, with the release of new [g]enerative AI chatbots such as ChatGPT and Bard. The economic impact of AI is likely to be significant; a recent Goldman Sachs report projected that “generative AI has [the] potential [to] boost global labour productivity by more than 1 percentage point a year in the decade following widespread usage”. [footnote 170] The UK is well placed to capture these gains as third in the world for AI investment; the AI sector already contributes £3.7 billion to the UK economy and employs 50,000 people across the country. [footnote 171]

To realise the many potential benefits of AI, the UK needs to work with international partners to ensure the safe development of advanced AI systems. The UK is taking a leading role in this area, having hosted the world’s first AI Safety Summit earlier this month. The government will be launching the first AI Safety Institute, backed by an initial £100 million investment. In parallel, the government is developing its wider regulatory approach, to balance innovation and safe adoption, publishing its response to the AI white paper by the end of the year, and launching a pilot AI Regulatory Sandbox in the spring. [footnote 172] Later this year the government will be launching the Manchester Prize which will award prizes of up to £1 million to researchers working on the safe, responsible application of AI over the next 10 years.

Key to the UK creating a world-leading AI ecosystem is access to compute, which powers the development of AI models. In the last year, the government has announced significant compute investments, including £900 million at Spring Budget 2023. The government will be investing a further £500 million in compute for AI over the next two financial years bringing the total planned investment in compute to more than £1.5 billion. These investments will allow researchers and SMEs to develop new foundation models and maximise the UK’s potential in AI, enabling, for example, the discovery of new drugs. This complements the government’s £100 million AI Life Sciences Accelerator Mission, announced by the Prime Minister, which will use health data and cutting-edge AI to address some of the most pressing health challenges facing the nation.

Together these investments will support the UK to unlock the potential of AI, from the development and testing of advanced AI models, to creating the conditions for further innovation and the safe application of AI across the economy.

Life Sciences

Life sciences is a strength of the UK economy, with the sector critical to the country’s health, wealth and resilience. In May 2023, the government committed £121 million in funding as a first response to Lord O’Shaughnessy’s recommendations on improving the UK’s commercial clinical trial offer. The government has published its full response to the review, supported by an implementation plan, to make the UK one of the best places in the world to conduct clinical research. Up to £20 million of this funding will launch the first Clinical Trial Delivery Accelerator, focused on dementia, to help innovation reach NHS patients even faster.

To build resilience for future health emergencies and to capture and capitalise on the UK’s R&D strengths, the government is providing £520 million in funding from 2025‑26 to support transformational manufacturing investments in life sciences. It is also backing UK innovation by investing £10 million, with an additional £10 million from Scottish Enterprise, in a world class Manufacturing Centre of Excellence in Oligonucleotides. Tackling antimicrobial resistance will be essential for future health resilience, so to mark the 2028 centenary of the discovery of penicillin, the government is granting £5 million seed funding to help launch the Fleming Centre. A collaboration led by Imperial College London and Imperial College Healthcare NHS Trust, the Centre will support the next generation of world-changing health innovations.

The UK is uniquely placed to harness the power of health data to improve patient outcomes. In England the NHS has 1.6 million patient interactions every 24 hours generating real world experience and insights at scale. [footnote 173] The government is therefore announcing a further £51 million for the Our Future Health (OFH) programme, a world-leading resource for health research, to genotype their first 1 million participants and to recruit hundreds of thousands of new volunteers, supporting the development of better ways to prevent, detect and treat diseases. The COVID-19 vaccine showed the UK is one of the best places to launch lifesaving therapies. Building on this legacy, Genomics England, along with a consortium of partners, is announcing the launch of a world first Rare Therapies Launch Pad, generating evidence on whether a pathway for new individualised therapeutics could be implemented in the UK for children with ultra-rare disease.

The government has reached an in-principle agreement with the pharmaceutical industry on the 2024 Voluntary Scheme for Branded Medicines Pricing, Access, and Growth. The scheme is expected to deliver around £14 billion in savings to the NHS across the next five years, as well as supporting rapid patient access to new clinically and cost-effective medicines. A £400 million fund will also be established by industry to support investment in the UK life sciences ecosystem, including improved clinical trial capacity.

Creative industries

The UK has world-leading creative industries at the heart of an increasingly digital world. The sector grew at over one and a half times the rate of the wider economy between 2010 and 2019, [footnote 174] contributing £126 billion in GVA in 2022. [footnote 175] In June 2023, the government published its Sector Vision which set ambitions to grow the creative industries by £50 billion and deliver a creative careers promise to support a million more jobs by 2030. This included £77 million in new government spending, bringing the total announced since the 2021 Spending Review to £310 million. The sector also continues to be supported by significant tax reliefs, which were worth £1.66 billion in the year ending 2022. [footnote 176]

The government expects further growth and a rise in employment as creative industries embrace new technologies. To maximise the benefits of this, the government will further boost the international competitiveness of tax incentives for the UK’s world-leading visual effects sector. The government intends to increase the generosity of the Audio-Visual Expenditure Credit for visual effects expenditure, and will work with industry on how best to design this with the intention of implementing changes to the tax relief from April 2025.

To support the production of film and high-end TV across the UK, the government will provide £2.1 million of new funding next year for the British Film Commission and the British Film Institute Certification Unit. Furthermore, the government will review public investment in R&D spending for the creative industries to a Spending Review timeframe.

Making a long-term investment in skills by delivering a world-class education system

A crucial part of securing Britain’s prosperity for future generations is building a world-class education and skills system. Long-term investment in human capital is crucial for growth and productivity: changes in labour quality contributed to around 15% of growth in labour productivity between 2001 and 2007, and the majority of labour productivity growth in the years after. [footnote 177] This is why the government continues to make year on year increases to school funding in England, boost opportunities for adults to train, upskill and retrain, and, from 2025, transform the student finance system through the Lifelong Learning Entitlement.

In October 2023, the Prime Minister announced a strong action plan to ensure every student has the literacy and numeracy skills they need to thrive through the introduction of the Advanced British Standard. This new Baccalaureate-style qualification will bring the best of A-Levels and T-Levels together, creating a unified structure that puts technical and academic education on equal footing. This reform will ensure every student in England studies some form of maths and English to age 18, boosting basic skills and bringing the UK in line with international peers. It will increase the number of taught hours by 15% for most students aged 16 to 19 and will broaden the number of subjects students take.

The government is funding a down payment of over £600 million over the next two years. This will give teachers in key shortage academic and technical subjects – who are in the first five years of their career – a payment of up to £6,000 per year tax free, including further education colleges for the first time; support students to achieve their maths and English GCSEs where they did not pass first time; improve the quality of maths teaching; and build a deeper understanding of what works in 16-19 teaching and training with a £40 million capital investment into the Education Endowment Fund.

Beyond 16-19 education, the government is supporting employer-based training in England so that adults of all ages can access high quality apprenticeships. The government has transformed apprenticeships to offer a prestigious and high quality alternative route to higher education. In 2021-22, almost a third of all starts were at Level 4 and above compared to only 4% in 2014-15. [footnote 178]

The government continues to work closely with businesses to improve the apprenticeship system to meet the needs of learners, employers and training providers. The government is supporting plans to catalyse the growth sectors by committing £50 million to deliver a two-year apprenticeships pilot to explore ways to stimulate training in these sectors and address barriers to entry in high-value standards.

Boosting growth and investment across the country

To grow the economy, the government is committed to building on the potential of all areas across the UK, and to tackling the unequal spread of opportunity. The recently launched Round 3 of the Levelling Up Fund and the Long-Term Plan for Towns will continue to deliver on this ambition.

At Spring Budget 2023, the government launched the refocussed Investment Zones programme. The government is now going further by extending the Investment Zones programme from five to ten years, which will double the envelope of funding and tax reliefs available in each Investment Zone from £80 million to £160 million, to provide greater certainty to investors. The government is also extending the duration of the tax reliefs available in Freeports from five to ten years to maximise the programme’s impact. To ensure Investment Zones and Freeports can respond nimbly as investment opportunities arise, the government is also creating a new £150 million Investment Opportunity Fund, which will be available over five years.

The government is also announcing the next set of Investment Zones.

• The Greater Manchester Investment Zone will focus on advanced manufacturing and materials and local partners expect it to help to leverage £1.1 billion in private investment and help to create 32,000 jobs in the region over the next 10 years.
• The West Midlands Investment Zone will focus on advanced manufacturing and local partners expect it to help to leverage £2 billion in private investment and help to create 30,000 jobs in the region over the next 10 years.
• The East Midlands Investment Zone, with a focus on green industries and advanced manufacturing, is expected by local partners to help to leverage £383 million in private investment and help to create 4,200 jobs in the region over the next 10 years.

All of these Investment Zones have received anchor investment from private sector companies.

The government continues to make good progress on developing the Investment Zones for the North East and Tees Valley. The government is also confirming that there will be two Investment Zones in Wales; one located across the Cardiff and Newport area, and delivered by the South East Wales Corporate Joint Committee, and another focusing on the Wrexham and Flintshire region delivered by the North Wales Corporate Joint Committee. The government has now confirmed details of 6 of 13 Investment Zones in the UK and will work with local partners with the aim of confirming details of all Investment Zones by summer 2024.

To deepen devolution in England and further empower local leaders to drive growth in their areas, the government has agreed with local partners a Memorandum of Understanding outlining the approach to the single funding settlements which will be implemented at the next Spending Review for the West Midlands and Greater Manchester Combined Authorities. The government is also publishing a new ‘Level 4’ of the devolution framework. Devolved institutions with a directly elected leader that meet eligibility requirements will be able to draw down from this framework, which delivers deeper powers alongside new scrutiny expectations. The powers include new levers over local transport, reflecting the substantial progress made towards the National Infrastructure Commission’s recommendation to devolve local transport powers and funding to local authorities. The government has already agreed to negotiate a further trailblazer devolution deal with the North East and discussions have now commenced with a view to finalising a deal in spring 2024. The deal will empower local leaders to develop existing and potential industrial strengths across the region, from creative industries to advanced manufacturing.

The government is also announcing four new devolution deals and an intention to expand Level 2 devolution to eligible councils across England that represent a whole county or functional economic area. This includes new Level 3 deals with Greater Lincolnshire, and Hull and East Yorkshire, and Level 2, non‑mayoral, deals with Cornwall and Lancashire. Combined, these new deals, and the extended Level 2 offer, could increase the proportion of people in England benefiting from devolved powers to over two-thirds.

Building on this support for growth across the UK, the government is announcing:

• £80 million for the expansion of the Levelling Up Partnerships programme to Scotland, for Na h-Eileanan an Iar, Argyll and Bute, Dundee, and the Scottish Borders, and will consider how to extend the programme further;
• over £50 million to support regeneration in places across the UK: Bolsover, the Isles of Scilly, Warrington, North Norfolk, Eden and Monmouthshire;
• support for the Hay festival in Wales;
• the reallocation of £20 million from within the Inverness & Highland City Region Deal to fund essential landside infrastructure improvements for the Corran Ferry, subject to agreement through the appropriate Deal governance structures; and
• confirming £3 million for the Tackling Paramilitarism Programme in Northern Ireland

Investing in housing supply

Building homes in the right places, where people want to live and work, will support economic growth across the UK and make home ownership a reality for more people.

The government is investing an additional £32 million across housing and planning to unlock thousands of homes across the country. This includes additional funding to tackle planning backlogs in Local Planning Authorities (LPA), alongside further reforms to streamline the system through a new Permitted Development Right to enable one house to be converted into two homes.

Funding will also accelerate the delivery of new high quality housing in Cambridge, Leeds and London. As part of this, the government will support the Cambridge Delivery Group to drive the long-term vision for Cambridge by exploring the case for a development corporation. The government is also continuing to progress its commitment to deliver East West Rail, with a statutory consultation due next year and, as part of Network North, has committed to providing £2.5 billion for a West Yorkshire mass transit system. Subject to the business case, the government will also provide funding for a rapid transit bus network in Thamesmead, as part of its vision for a new Docklands 2.0.

Today the government is also confirming £110 million will be made available through the Local Nutrient Mitigation Fund. This will support LPAs affected by nutrient neutrality rules to deliver high quality local nutrient offsetting schemes, unlocking up to 40,000 homes over the next five years. [footnote 179]

The government remains committed to building the affordable homes this country needs, building on the success of the existing Affordable Homes Guarantee Scheme through a £3 billion extension which will help the scheme deliver 20,000 new homes, as well as improving the quality and efficiency of thousands more. [footnote 180] The government is also extending until June 2025 the Public Works Loan Board policy margin announced at Spring Budget 2023 to support local authority investment in social housing, as well as delivering an additional 2,400 homes by allocating £450 million to a third round of the Local Authority Housing Fund, which will provide additional funding for new Temporary Accommodation as well as homes for Afghan refugees.

The government will extend ‘thank you’ payments into a third year for Homes for Ukraine sponsors across the UK. These will remain at £500 per month and reflect the ongoing generosity of hosts in supporting those who have fled the war. The government is also providing £120 million funding for the devolved administrations and local authorities in England to invest in homelessness prevention, including to support Ukrainian households who can no longer remain in sponsorship.

As well as building the homes of the future, this government is committed to supporting home movers with a range of measures to improve the buying and selling process, including pilots to develop property tech products and digitise local council property data.

Box 4.B Creating a simpler, more effective tax system

Tax simplification.

The government has four main objectives on tax simplification, to support growth and fairness:

• Tax rules should have a clear consistent rationale and be easy to understand.
• The burden of compliance and administration should be proportionate for taxpayers and HMRC and it should be easy for taxpayers to get their tax right.
• Taxpayers should be able to understand their obligations and options particularly at key lifecycle points, such as when they do something for the first time or infrequently.
• Tax policy should not unnecessarily distort the decisions of taxpayers and result in poorly informed choices.

The government will measure annual progress against these objectives, focusing on taxpayers’ experience and prioritising the impact of complexity on individuals and small businesses. The government will update on these metrics before the end of 2023-24.

Building on reforms announced at Spring Budget 2023, the government is now making it easier for small businesses as they set up and grow by:

• Expanding the ‘cash basis’ – a simplified way for over four million sole traders and partners to calculate and pay their Income Tax.
• Introducing a package of changes to simplify the design of Making Tax Digital (MTD) for Income Tax Self Assessment (ITSA), that will benefit around 1.7 million businesses and landlords set to be mandated to use MTD.
• Merging the R&D Expenditure Credit (RDEC) and the SME scheme by combining the best parts of both reliefs under a common set of rules and removing the situation where companies have to transition between the SME and RDEC schemes.

As announced in the Spring, the government is undertaking a systematic review of guidance and key forms for small business and has already made improvements: including enhanced guidance when checking if you need to submit an ITSA return; new interactive guidance to help businesses register for ITSA; and improved guidance making it easier to report VAT errors.

To simplify the experience of interacting with the tax system for individuals, the government has already increased to £150,000 the threshold for individuals with income taxed only through Pay As You Earn to file a Self Assessment return. From the tax year 2024-2025, it is abolishing the threshold altogether. These changes remove the requirement for up to 338,000 taxpayers to submit a return.

To simplify the experience for the self-employed who currently have to pay two National Insurance contributions (NICs) charges the government will abolish the outdated and needlessly complex Class 2 self-employed NICs. From 6 April 2024 the government will remove the requirement to pay Class 2 NICs but will maintain access to contributory benefits including the State Pension. Those currently paying voluntarily will still be able to do so. The government will set out next steps on Class 2 reform next year. As part of this reform the government will protect the interests of lower paid self-employed people who currently pay Class 2 NICs voluntarily to build entitlement to certain contributory benefits including the State Pension. This change simplifies the tax affairs of around 2 million people.

The government is also making it easier for people to choose the best ISA accounts for their needs and move money between them.

The government is also simplifying the tax system for large businesses. Tax professionals have welcomed the simplicity of full expensing that was due to come to an end in March 2026, and the government has announced that this will be made permanent. The government will take this opportunity to determine how the capital allowances legislation could be simplified in consultation with industry.

Tax simplification is an ongoing priority for this government, and it will aim to demonstrate progress on this agenda at every fiscal event.

 International taxation – OECD Pillar 2

The government is committed to delivering the landmark G20/OECD two-pillar reform to the international tax system in response to the challenges posed by the digitalisation of the economy, which was brokered by the Prime Minister as part of the UK’s G7 presidency in 2021.

Pillar 2, which is being implemented from 2023, will ensure Multinational Enterprises (MNEs) will be subject to a minimum 15% effective tax rate in every jurisdiction in which they operate. Implementation of these rules will protect the UK from aggressive tax planning by large multinationals, help ensure that profits made in the UK are taxed in the UK, and level the playing field for tax competition that has been tipped in favour of no or low tax jurisdictions.

The Multinational Top-up Tax, Domestic Minimum Tax and Undertaxed Profits Rule are expected to raise approximately £12.7 billion in the UK in total over the next 6 years. If the UK had not implemented these rules, this tax would have been collected elsewhere.

It is important that the UK implements Pillar 2 to a similar timeline as other countries. More than 30 countries across the world have taken steps towards implementation. Other countries moving to implement Pillar 2 from 31 December 2023 or 1 January 2024 include members of the European Union, where a Directive obliges all but the smallest Member States to implement Pillar 2 from 31 December 2023, Australia, Canada, New Zealand, South Korea, Switzerland and Vietnam. Japan is implementing from 1 April 2024. Jurisdictions implementing in 2025 so far include Thailand and Singapore with many more countries expected to follow. The government will continue to monitor international developments on implementation.

Policy Decisions

This chapter sets out all Autumn Statement 2023 policy decisions. Unless stated otherwise, the decisions set out are ones which are announced at the Statement. Table 5.1 shows the cost or yield of all government decisions accounted for at Autumn Statement 2023 which have a direct effect on Public Sector Net Borrowing (PSNB) in the years up to 2028-29. This includes tax measures, changes to aggregate Departmental Expenditure Limits (DEL) and measures affecting annually managed expenditure (AME). The government is also publishing the methodology underpinning the calculation of the fiscal impact of each policy decision. This is included in ‘Autumn Statement 2023: policy costings’ published alongside the Autumn Statement.

Where measures set out in the Autumn Statement do not apply UK-wide, the government will provide the devolved administrations with funding through the Barnett formula in the usual way. The Scottish and Welsh Governments’ funding will also be adjusted in relation to tax and welfare devolution as set out in their respective fiscal frameworks.

Table 5.1: Autumn Statement 2023 policy decisions (£ million)(1)

Economic and fiscal outlook.

Research fund on risks to the economic and fiscal outlook – The government will provide up to £10 million of funding over 2024-25 and 2025‑26 to finance research on risks to the economy and public finances, including the understanding of risk impacts, their potential mitigations and response preparations.

Economic Advisory Council – The Chancellor is standing down the Economic Advisory Council (EAC), which was set up last autumn to provide independent advice on economic and financial market issues. The government thanks the Council for their expertise, and will continue to seek advice from experts on issues under consideration including long-term economic challenges.

DEL Spending Assumption from 2025-26 to 2028-29 – Planned departmental resource spending for the years beyond the current Spending Review period (2025-26 to 2028-29) will continue to grow at 1% a year on average in real terms, excluding the funding provided to local authorities in 2024-25 as part of the one-year Retail, Hospitality, and Leisure relief scheme. Departmental capital spending will follow the cash profile agreed at Spring Budget 2023, with new commitments funded in addition to this, including further support for levelling up programmes and business access to finance.

Support for Veterans – The government is providing an additional £10 million to support the Veterans’ Places, People and Pathways Programme to increase support to a significant community of vulnerable veterans throughout the UK and enable it to become self-sustaining.

Apprenticeships – The government is committing a further £50 million for a 2-year pilot to explore ways to stimulate training in growth sectors and address barriers to entry in high-value apprenticeships.

Support for affected communities within the UK following the conflict in Israel and Gaza – The £3 million of additional funding that the government has already provided to the Community Security Trust will be maintained in 2024-25. In addition, the government is also providing up to £7 million over three years for organisations like the Holocaust Educational Trust to help tackle antisemitism in schools and universities.

Productivity Programme – The Chief Secretary to the Treasury is running an ambitious public sector productivity programme.

International

Official Development Assistance (ODA) Spending – The government has committed to return to spending 0.7% of Gross National Income (GNI) on ODA when it is not borrowing for day-to-day spending and underlying debt is falling, as reviewed each year against the latest fiscal forecast for the following year. Autumn Statement 2023 confirms that these conditions have not been met for 2024-25.

Tariff suspensions – The government is maintaining tariff-free imports on over 2,000 goods to provide continuity and avoid unnecessary costs for UK businesses. This measure will extend, for five years, tariff suspensions on goods ranging from vaccine components to ingredients used by UK food producers.

Uplift to the UK’s Core Voluntary Contribution to the World Health Organisation (WHO) – The government is increasing its core funding to the WHO by £2 million for underfunded priorities.

Cutting taxes and rewarding hard work

National Insurance contributions (NICs) rates  – The government will cut the main rate of Class 1 employee NICs from 12% to 10%. This will take effect from 6 January 2024. The government will also cut the main rate of Class 4 self-employed NICs from 9% to 8%. This will take effect from 6 April 2024.

From 6 April 2024 the government will also ensure that no one will be required to pay Class 2 self-employed NICs. Details of this change are:

From 6 April 2024, self-employed people with profits above £12,570 will no longer be required to pay Class 2 NICs, but will continue to receive access to contributory benefits including the State Pension.

The government will set out next steps on Class 2 reform next year. As part of this reform the government will protect the interests of lower paid self-employed people who currently pay Class 2 NICs voluntarily to build entitlement to certain contributory benefits including the State Pension.

National Minimum & Living Wage Uprating – From 1 April 2024, the National Living Wage (NLW) will increase by 9.8% to £11.44 an hour for eligible workers across the UK aged 21 and over. Young people and apprentices on the National Minimum Wage (NMW) will also see a boost to their wages.

Restart scheme – The government is expanding its programme of employment support for the long-term unemployed for two years from 2024 across England and Wales. Those who have been on Intensive Work Search for 6 months will now be eligible, as opposed to the previous requirement of 9 months. In addition, work coaches will track the activity of participants to ensure they comply with requirements of the Restart programme.

Post-Restart Claimant review point – From late 2024, Universal Credit claimants in England and Wales who have completed Restart and remain unemployed after 18 months will undergo a review conducted by a work coach. Claimants who do not agree to revised claimant commitments without a good reason, which could include attending a mandatory work placement or new intensive work search activities, will have their claim closed.

Post-Restart employment schemes, including Mandatory Work Placements – From late 2024, the government will begin rolling out new schemes to support Universal Credit claimants in England and Wales, who have completed Restart and remain unemployed after 18 months. Following the post-Restart claimant review point, claimants will be mandated to attend a time-limited work placement or undertake other intensive work activity.

Additional Jobcentre Support – The government is expanding Additional Jobcentre Support currently live in 90 Jobcentres in England and Scotland to trial intensive support for people who have been receiving Universal Credit for 7 weeks, in addition to the support after 13 and 26 weeks announced at Spring Budget 2023.

Strengthening the application of Universal Credit sanctions – The government is investing in digital tools that will allow work coaches to track claimant attendance at job fairs and interviews organised by a Jobcentre Plus in Great Britain.

Closing claims for disengaged UC claimants on open-ended sanction for over 6 months – The government will take steps to close the claims of sanctioned Universal Credit claimants in Great Britain who have not engaged with Jobcentre support for over 6 months and are solely eligible for the Universal Credit standard allowance.

Investigating sanctioned claimants through the Targeted Case Review – The government will use its Targeted Case Review process to investigate sanctioned Universal Credit claimants in Great Britain who have not engaged with Jobcentre support for over eight weeks who are still receiving some Universal Credit payments, ensuring they receive the right entitlement.

Individual Placement and Support expansion – The government will expand access to Individual Placement and Support (IPS) for severe mental illness, an employment support service within community mental health teams in England, to reach an additional 100,000 people over the next 5 years.

NHS Talking Therapies expansion – The government will expand access to NHS Talking Therapies in England, the flagship NHS programme for treating mild and moderate mental health conditions, to reach an additional 384,000 people over the next 5 years, and increase the number of sessions available to those that use the service.

Universal Support expansion – Universal Support is a supported employment programme in England and Wales for people with a disability or health condition. The government will double the number of yearly places on Universal Support to 100,000.

Occupational Health – The government will establish an expert group to develop a voluntary minimum framework which will set out the minimum level of Occupational Health intervention that employers could adopt to help improve employee health at work.

Work Capability Assessment (WCA) gateway reform – The government is reforming the activities and descriptors in the Work Capability Assessment for new claimants in Great Britain, to support more people into employment, with implementation occurring from 2025.

Fit note reform – The government will explore end-to-end reforms of the fit note process to support more people to resume work after a period of illness. Trailblazer trials, in a small number of areas in England, will test changes to make referrals to health and employment services easier and improve digital access for patients. They will include trigger points for referrals for people who have received a fit note for a prolonged period of time and new designs of the fit note form. The government will launch a consultation in 2024 on wider reforms, to examine providing individuals whose health affects their ability to work, with easy and rapid access through the fit note process to specialised support for a return to work.

Supporting vulnerable people

Raising Local Housing Allowance (LHA) rates – In April 2024, LHA rates in Great Britain will be raised to the 30th percentile of local market rents.

Uprating of benefits – The government is increasing working age benefits in line with inflation, measured by September CPI which is 6.7% this year. The government is also maintaining the Triple Lock. The basic State Pension, new State Pension and Pension Credit standard minimum guarantee will be uprated in April 2024 in line with earnings growth. This is measured by the usual metric of annual earnings growth in May-July, which is 8.5% this year. Over 19 million families will see their benefit payments increase from April 2024. Some disability benefits are devolved in Scotland, so it is for the Scottish Government (SG) to decide uprating. Department for Work and Pensions (DWP) benefits are fully devolved in Northern Ireland, so it is for the Northern Ireland Executive to decide uprating in Northern Ireland.

DWP: new powers to tackle fraud and error – The government is legislating to give DWP further access to claimant data to better identify fraud and error in the welfare system in Great Britain.

Personal Independence Payment (PIP) easements – DWP is continuing operational measures to reduce the waiting time for new PIP claims in England & Wales. DWP’s ability to use these measures has been extended until November 2024, to ensure that new disability benefit claimants are not facing excessive wait times to have their benefits claims processed.

Universal Credit surplus earnings – The government will maintain the surplus earnings threshold for Universal Credit claimants in Great Britain at £2,500 for a further year until April 2025.

Universal Credit: Severe Disability Premium Transitional Element rates – The government will increase the rates of the Severe Disability Premium Transitional Element to provide further support for legacy benefit claimants in Great Britain that naturally migrate to Universal Credit.

Increasing the Minimum Income Floor for self-employed lead carers on Universal Credit – The government will increase the level of the Minimum Income Floor in Great Britain for lead carers of children aged 3-12 who are self-employed. This will align it with the new work-related activity requirements for employed lead carers, which were announced at Spring Budget 2023.

Tackling the Economic Impacts of Domestic Abuse (TEIDA) Fund – The government will make £10 million of additional funding available in 2024-25 for projects that aim to understand the impacts of domestic abuse on the labour market, support victims of domestic abuse in the workplace or prevent victims experiencing further abuse.

Expanding the Flexible Fund for victims of domestic abuse – The government will provide £2m of additional funding to expand the Flexible Fund, which trials an innovative new approach to provide one off payments to victims of domestic abuse. This support will reduce the financial pressure on victims to return to the abuser and will enable victims to set themselves up sustainably, for example by securing long term accommodation.

Help to Save – The government will reform the Help to Save scheme for low-income workers and will publish proposals in a response to the consultation on Help to Save Reform, as well as consulting on delivery of the new scheme.

Personal Tax and Savings

ISA: Allowing multiple ISA subscriptions – The government will allow multiple subscriptions to ISAs of the same type every year from April 2024.

ISA: Allowing partial transfers between providers – The government will allow partial transfers of ISA funds in-year between providers from April 2024.

ISA: Removing the requirement to reapply for an existing ISA annually – The government will remove the requirement to reapply for an existing dormant ISA from April 2024.

ISA: Expanding the Innovative Finance ISA to include Long-Term Asset Funds – The government will allow Long-Term Asset Funds to be permitted investments in the Innovative Finance ISA from April 2024.

ISA: Expanding the Innovative Finance ISA to include open-ended property funds with extended notice periods – The government will allow open-ended property funds with extended notice periods to be permitted investments in the Innovative Finance ISA from April 2024.

ISA: Allowing certain fractional shares contracts as a permitted investment – The government intends to permit certain fractional shares contracts as eligible ISA investments and will engage with stakeholders on implementation.

ISA: Digitalise the ISA reporting system – The government is announcing the digitalisation of the ISA reporting system to enable the development of digital tools to support investors.

ISA: Harmonise ISAs to those over 18 years of age – The government will harmonise the account opening age for any adult ISAs to 18 from April 2024.

ISA, JISA, LISA & CTF Annual Limits – The government is freezing the Individual Savings Account (£20,000), Junior Individual Savings Account (£9,000), Lifetime Individual Savings Account (£4,000 excluding government bonus) and Child Trust Fund (£9,000) limits at their current levels for 2024-25.

LTA Abolition – The government will legislate in the Autumn Finance Bill 2023 to remove the Lifetime Allowance. The measure will clarify the taxation of lump sums and lump sum death benefits, and the application of protections, as well as the tax treatment for overseas pensions, transitional arrangements, and reporting requirements. This will take effect from 6 April 2024.

Uprating Blind Person’s Allowance and Married Couple’s Allowance for 2024-25 – The government will uprate the Blind Person’s Allowance (BPA) and the Married Couple’s Allowance (MCA) by the September CPI figure of 6.7% in 2024-25. The BPA will be valued at £3,070 and the MCA will be valued at between £4,280 and £11,080. This decision represents no policy change, as it confirms the default position for these allowances to be uprated by CPI, as set out in the Income Tax Act 2007.

Taxation of the pension remedies for Members of Parliament, Members of the Senedd and Members of the Legislative Assembly – The government will legislate in the Autumn Finance Bill 2023 to modify how the pensions tax framework applies to certain redress payments made from the Parliamentary Contributory Pension Fund, the Members of the Senedd Pension Scheme, and the Assembly Members’ Pension Scheme. This will align scheme members’ tax treatment with that of the wider public sector in relation to the McCloud judgment.

Off-Payroll Working (IR35) – calculation of PAYE liability in cases of non‑compliance – The government will legislate in the Autumn Finance Bill 2023 to allow HMRC to reduce the PAYE liability of a deemed employer to account for taxes paid by a worker and their intermediary on payments received where an error has been made in applying the off-payroll working rules.

National Insurance contributions rates and thresholds – The government will freeze the Lower Earnings Limit (LEL) and the Small Profits Threshold (SPT) at 2023-24 levels in 2024-25. For those paying voluntarily, the government will also freeze Class 2 and Class 3 National Insurance contribution (NIC) rates at their 2023-24 levels in 2024-25. The LEL will remain at £6,396 per annum (£123 per week) and the SPT will remain at £6,725 per annum. The main Class 2 rate will remain at £3.45 per week, and the Class 3 rate will remain at £17.45 per week. This will not affect existing arrangements for payments of voluntary Class 2 or Class 3 NICs connected with previous tax years.

Extending the Employer NICs relief for employment of veterans – The government is extending the NICs relief for employers of eligible veterans for one year. The relief means businesses pay no employer NICs on annual earnings up to £50,270 for the first year of a qualifying veteran’s employment in a civilian role.

Legislative correction to Scottish Government’s Carer Allowance Supplement reference – A technical change will be made to Table A of section 660 of the Income Tax (Earnings and Pensions) Act 2003 (ITEPA) in the Autumn Finance Bill 2023, to ensure that the legislative reference to the Scottish Government’s Carer Allowance Supplement is correct.

Announcement of future guidance changes to tax relief for self-employed – The government is announcing that HMRC will rewrite guidance around the deductibility of training costs for sole traders and the self-employed. This measure will clarify the guidance to ensure that individuals can be confident that updating existing skills, maintaining pace with technological advances, or changes in industry practices are allowable costs when calculating the taxable profits of a business.

Simplifying Making Tax Digital for Income Tax Self Assessment – The government is announcing the outcome of the review into the impact of Making Tax Digital (MTD) for Income Tax Self Assessment (ITSA) on small businesses. This includes maintaining the current MTD threshold at £30,000 and design changes to simplify and improve the system. These changes will take effect from April 2026. The government is also legislating in the Autumn Finance Bill 2023 to ensure taxpayers, who join MTD from 6 April 2024, are subject to the government’s new, fairer penalty regime for the late filing of tax returns and late payment of tax.

Response to consultation on taxation of environmental land management and ecosystem service markets – At Spring Budget 2023, the government launched a consultation on the taxation of environmental land management and ecosystem service markets. This closed on 9 June 2023. The government is currently reviewing responses to this consultation and will give a further update in Spring 2024.

Investment in HMRC debt management capability – The government is investing a further £163 million to improve HMRC’s ability to manage tax debts. This will allow HMRC to better distinguish between those who can afford to settle their tax debts, but choose not to, from those who are temporarily unable to pay and need support. HMRC will also expand its debt management capacity to support both individual and business taxpayers out of debt faster and collect debts that are due.

Construction Industry Scheme (CIS) reform: reforms to the Gross Payment Status test – The government will introduce reforms in the Autumn Finance Bill 2023 to the Construction Industry Scheme, including adding VAT as part of the Gross Payment Status (GPS) compliance test, giving HMRC more power to remove GPS immediately in cases of fraud. Alongside this, the government is also announcing simplifications to other aspects of the scheme, which will be subject to technical consultation.

Tougher consequences for promoters of tax avoidance – The government is legislating in the Autumn Finance Bill 2023 to introduce tougher consequences for promoters of tax avoidance schemes. These include a new criminal offence for those who continue to promote avoidance schemes after receiving a notice requiring them to stop; and a new power enabling HMRC to bring disqualification action against directors of companies involved in promoting tax avoidance, including those who control or exercise influence over a company. These changes will take effect from Royal Assent of the Autumn Finance Bill 2023.

Improving the data HMRC collects from its customers – The government is legislating in the Autumn Finance Bill 2023 to require employers, company directors, and the self-employed to provide new or improved data to HMRC to enable better outcomes for citizens and businesses. These changes will take effect from the tax year 2025-26.

Reforming requirements to file a Self Assessment tax return – The government will no longer require individuals with income taxed only through Pay As You Earn to file a Self Assessment return from 2024-25.

Business Tax

Capital allowances: permanent full expensing – Full expensing will be made permanent in the Autumn Finance Bill 2023, so that investments made by companies in qualifying plant and machinery, after 1 April 2026, will continue to qualify for a 100% first-year allowance for main rate assets, and a 50% first-year allowance for special rate (including long life) assets. Cars, assets for leasing and second-hand assets will be excluded from these 100% and 50% first-year allowances.

Capital allowances: Technical consultation on extending full expensing to assets for leasing – Assets for leasing remain excluded from full expensing. The government will continue to consider whether there is a case to extend full expensing to leasing. The government will publish a technical consultation in due course to seek input on draft legislation which will help to determine whether error and abuse risks are appropriately mitigated. The government will consider consultation responses before reaching any final decision.

Business rates: multiplier – For 2024-25, the small business multiplier in England will be frozen for a fourth consecutive year at 49.9p, while the standard multiplier will be uprated by September CPI to 54.6p.

Business rates: retail, hospitality, and leisure relief – The current 75% relief for eligible Retail, Hospitality and Leisure (RHL) properties is being extended for 2024-25, a tax cut worth £2.4 billion. Around 230,000 RHL properties in England will be eligible to receive support up to a cash cap of £110,000 per business.

New Burdens Funding – English Local Authorities will be fully compensated for the loss of income as a result of these business rates measures and will receive new burdens funding for administrative and IT costs.

Stamp Duty and Stamp Duty Reserve Tax – Widening access to the Growth Market Exemption – The government is extending the Growth Market Exemption, a relief from Stamp Duty (SD) and Stamp Duty Reserve Tax (SDRT), to include smaller, innovative growth markets. It will also increase the threshold for the market capitalisation condition that is used within the exemption from £170 million to £450 million. These changes will be included in the Autumn Finance Bill 2023 for implementation from 1 January 2024.

Offshore Receipts in respect of Intangible Property (ORIP) – The government will abolish the ORIP rules in respect of income arising from 31 December 2024. ORIP’s repeal will be legislated for in an upcoming Finance Bill, and take place alongside the introduction of the Pillar 2 Undertaxed Profits Rule, which will more comprehensively discourage the multinational tax-planning arrangements that ORIP sought to counter.

Post Office Compensation Schemes, Corporate Entities – The government will legislate in the Autumn Finance Bill 2023 to exempt from Corporation Tax compensation payments made under the Historical Shortfall Scheme (HSS), Group Litigation Order (GLO) schemes, Suspension Remuneration Review (SRR) or Post Office Process Review Scheme (PPR). The legislation will align the taxation of onward payments of compensation to that of individual recipients.

OECD Pillar 2 – The government will introduce the Undertaxed Profits Rule, which forms part of the G20-OECD global minimum tax framework, in the UK for accounting periods beginning on or after 31 December 2024, with legislation included in an upcoming Finance Bill. It will also make technical amendments to the Multinational Top-up Tax and Domestic Top-up Tax legislation through the Autumn Finance Bill 2023.

Real Estate Investment Trusts (REITs) – Further to the publication of draft legislation on 18 July 2023, the government will make amendments to the rules for Real Estate Investment Trusts (REITs) to enhance the competitiveness of the regime. Changes will variously take effect from Royal Assent of the Autumn Finance Bill 2023, apply to accounting periods ending on or after 1 April 2023, or are deemed to have always had effect.

Merger of R&D tax reliefs – The existing Research and Development Expenditure (RDEC) and SME schemes will be merged, with expenditure incurred in accounting periods beginning on or after 1 April 2024 to be claimed in the merged scheme. Merging schemes is a significant tax simplification, including an aligned set of qualifying rules and a more visible above the line credit. The notional tax rate applied to loss-makers in the merged scheme will be lowered from 25% as per the current RDEC scheme, to 19%. A note setting out the key changes to the policy following the technical consultation is published alongside the Autumn Statement, ahead of it being legislated for in the Autumn Finance Bill 2023.

R&D tax reliefs: additional tax-relief for R&D intensive loss-making SMEs – The intensity threshold in the additional support for R&D intensive loss-making SMEs will be reduced from 40% to 30%, bringing approximately 5,000 more R&D intensive SMEs into scope of the relief. The government will also introduce a one-year grace period, so that companies that dip under the 30% qualifying R&D expenditure threshold will continue to receive relief for one year. Businesses will be able to claim for expenditure incurred from 1 April 2023 once the Autumn Finance Bill 2023 has received Royal Assent, with the reduction in intensity threshold and grace period coming into effect for accounting periods beginning on or after 1 April 2024.

R&D tax reliefs: removing nominations and voiding assignments – From 1 April 2024, R&D claimants will no longer be able to nominate a third-party payee for R&D tax credit payments, subject to limited exceptions. In addition, no new assignments of R&D tax credits will be possible from 22 November 2023. This means that in most circumstances payments of R&D tax reliefs will be paid directly to the company that claims for the R&D, ensuring they have full oversight of the claim, and receive payment more quickly. This will be legislated in the Autumn Finance Bill 2023.

Closing the R&D review – At Spring Budget 2021, the government launched a review of R&D tax reliefs to ensure the UK remains a competitive location for cutting edge research, the reliefs continue to be fit for purpose and taxpayer money is effectively targeted. The government is now concluding that review with the announcement of the merged scheme. Further action may needed to reduce the unacceptably high levels of non-compliance in the R&D reliefs, and HMRC will be publishing a compliance action plan in due course. The government will also continue working with industry to develop the enhanced support for R&D intensive SMEs, and consider further simplifications.

Enterprise Investment Scheme (EIS) and Venture Capital Trust (VCT) extension – The government will legislate in the Autumn Finance Bill 2023 to extend the existing sunset clauses for the EIS and VCT from 6 April 2025 to 6 April 2035.

Annual Tax on Enveloped Dwellings (ATED): annual increase – The annual chargeable amounts for ATED will be uprated by the September CPI figure of 6.7% for the 2024-25 ATED charging period. This uprating is a routine change, as set out in existing primary legislation. The government will implement this change in the usual way through a Treasury Order.

Expanding the Cash Basis – Following a consultation at Spring Budget 2023, the government is expanding and simplifying the income tax cash basis for the self-employed and partnerships. These changes will take effect from 6 April 2024, for 2024-25 and will be included in the Autumn Finance Bill 2023.

Van Benefit Charge and Car & Van Fuel Benefit Charges – The government will maintain the Van Benefit Charge and the Car & Van Fuel Benefit Charges at 2023-24 levels for 2024-25.

Vehicle Excise Duty (VED) uprating & Heavy Goods Vehicles (HGV) VED and HGV levy freeze – The government will uprate VED rates for cars, vans and motorcycles in line with RPI from 1 April 2024 in the Autumn Finance Bill 2023. To support the haulage sector, VED for HGVs and the HGV levy will both remain at 2023-24 rates for 2024-25.

VAT Treatment of Private Hire Vehicles – The government will consult in early 2024 on the impacts of the July 2023 High Court ruling in Uber Britannia Ltd v Sefton MBC.

Women’s Sanitary Products – The government will extend the scope of the current VAT zero rate relief on women’s sanitary products to include reusable period underwear from 1 January 2024.

Alcohol duty – The government will freeze alcohol duties until 1 August 2024 and delay its annual uprating decision to Spring Budget 2024 to give businesses time to adapt to the duty system introduced on 1 August 2023.

Tobacco Duty Rates – Duty rates on all tobacco products will increase by RPI +2%. To reduce the gap with cigarette duty, the rate on hand-rolling tobacco will increase by RPI + 12% this year. These changes will take effect from 6pm on 22 November 2023 and will be included in the Autumn Finance Bill 2023.

Gaming Duty – The Gross Gaming Yield bandings for gaming duty will be frozen from 1 April 2024 until 31 March 2025.

Tax Treatment of Remote Gambling – The government will consult shortly on proposals to bring remote gambling (meaning gambling offered over the internet, telephone, TV and radio) into a single tax, rather than taxing it through a three-tax structure.

VAT Retail Export Scheme – The government is grateful for industry submissions on the VAT Retail Export Scheme and the associated airside scheme (tax-free shopping). The government will continue to accept representations and consider this new information carefully, alongside broader data.

Electricity Generator Levy: New Investment Exemption The government will legislate so that, where the substantive decision to proceed with a project to create a new electricity generation station or expand an existing generating station is made on or after 22 November 2023, receipts from that new generating station or additional capacity will not be subject to the Electricity Generator Levy.

Infrastructure, planning and regulation

Transmission Acceleration Action Plan – The government has announced a full response to the Electricity Network Commissioner’s report on accelerating electricity transmission network build, reducing the end-to-end process from 14 years to 7 years on average. Supporting this, the government has published proposals on community benefits for electricity transmission infrastructure and updated Energy National Policy Statements.

Connections Action Plan – The government has announced a joint action plan with Ofgem to drastically reduce the time it takes viable projects to connect to the electricity grid, ensuring Great Britain remains one of the best places in the world to connect.

NIC study on electricity distribution networks – The government is commissioning the National Infrastructure Commission to undertake a study on making the electricity distribution network fit for net zero.

Infrastructure planning – The government has published its response to the National Infrastructure Commission’s study on infrastructure planning reforms, with measures to return consent times to two and a half years on average, is designating low carbon infrastructure as a critical national priority in updated Energy National Policy Statements, and will consult on amending the National Planning Policy Framework to ensure that the planning system prioritises the rollout of electric vehicle charging infrastructure, including EV charging hubs, and also introduce new permitted development rights to end the blanket restriction on heat pumps one metre from a property boundary in England.

Planning system performance reforms – The Department for Levelling Up, Housing and Communities will bring forward plans for authorities to offer guaranteed accelerated decision dates for major developments in England in exchange for a fee, ensuring refunds are given where deadlines are not met and limiting use of extension of time agreements. This will also include measures to improve transparency and reporting of planning authorities’ records in delivering timely decision-making.

Support for substantial commercial development – The government will incentivise greater use of Local Development Orders to ensure key commercial developments are approved faster.

Consultation to Strengthen Economic Regulation – The government is consulting on proposals to strengthen the regulation of the energy, water and telecoms sectors, focussing on encouraging investment and growth.

Strengthening the regulators’ Growth Duty: Consultation – The government is publishing and consulting on new draft statutory guidance to update and strengthen the current Growth Duty guidance for regulators, asking regulators to report for the first time on actions taken under the Growth Duty, and monitoring the quality of reporting. The guidance will include a new expectation for regulators to deliver year-on-year improvements in approval times.

Government response to consultation on extending the Growth Duty to Ofcom, Ofwat and Ofgem – The government is extending the Growth Duty to these economic regulators and will introduce secondary legislation in 2024 to do so.

National Infrastructure Commission (NIC) study on connected and autonomous vehicles and mobility – The government is commissioning the NIC to undertake a study on how connected and autonomous vehicles and mobility can deliver growth.

Using smart regulation to boost market competition –The government is publishing a strategic steer to CMA, a consultation on options to reform the airport slot allocation system, and kickstarting a Smart Data Big Bang to explore potential of utilising new powers in the Digital Protection and Digital Information Bill across 7 sectors: energy, banking, finance, retail, home-buying, transport and telecoms. The government is also introducing proposals to tackle hidden fees online and accepting the CMA’s recommendations to improve the clarity of price labelling in stores.

Unlocking investment in growth through pension funds, the financial system, and international investment offer

Master Trust Review – The government is publishing a review of the Master Trusts market, five years after the 2018 Master Trusts regulations came into force, including market trends and the future of regulation and supervision.

Update on implementing the Value for Money framework – The government welcomes the Financial Conduct Authority (FCA) and the Pensions Regulator (TPR) announcements on next steps towards implementing the Value for Money framework in the defined contribution workplace pensions market. The FCA will consult on rules for contract-based schemes in Spring 2024, working closely with the government and TPR for consistency with the development of legislative requirements for trust-based schemes. In the meantime, actions from the TPR will strengthen their existing supervisory approach.

Update on saver choices at retirement – The government is publishing an update that proposes placing duties on occupational pensions trustees to offer decumulation services and products at an appropriate quality and price when savers access their pension assets, either themselves or through a partnership arrangement. It also sets out the intention to further explore the development and wider use of Collective DC schemes as part of a long-term vision for pension saving in the UK.

Call for Evidence on Lifetime Provider Model and small pots consultation response – The government is launching a call for evidence on a lifetime provider model to simplify the pensions market by allowing individuals to move towards having one pension pot for life, and on a potential expanded role for collective defined contribution (CDC) schemes in future. The government will also introduce the multiple default consolidator model to enable a small number of authorised schemes to act as a consolidator for eligible pension pots under £1,000.

Public consolidator for DB pension schemes – DWP will launch a consultation this winter on options for DB schemes, currently unserved by the market, to consolidate into a new statutory vehicle run by the Pension Protection Fund.

Solvency II Reform – The government announced reforms to Solvency II, the prudential regulatory regime for insurers, at Autumn Statement 2022. The government will be introducing secondary legislation to give effect to the reforms, delivering a more tailored, clearer, and simpler regulatory regime for the insurance sector, and incentivising private investment in long-term productive assets.

Growth Fund – Following positive feedback from industry, the government is confirming its intention to establish a Growth Fund within the British Business Bank. The Growth Fund will give pension schemes access to the BBB’s pipeline of opportunities, crowding private capital into the UK’s most promising businesses.

Long-term Investment for Technology and Science (LIFTS) – Subject to final agreement, the government will commit £250 million to two successful bidders under the LIFTS initiative. This will create new investment vehicles tailored to the needs of pension schemes, seeking to generate over a billion pounds of investment to support the UK’s most promising science and technology businesses.

Pension investment expertise and skills – The government supports the Pensions Regulator’s plans to implement a register of trustees to aid engagement with trustees and to update the trustee toolkit to include further information on productive finance.

Prioritising long-term pension investment performance over low fees – Building on the guidance and commitments made by the Productive Finance Working Group, the government will engage with industry on proposals to ensure that all aspects of the pensions market are playing their part to support best outcomes for savers. This will include how to shift employer incentives away from low fees towards long-term pension investment performance. The Pensions Regulator will provide further information for employers on what factors should be assessed when they are selecting a pension scheme.

Surplus extraction arrangements for DB pension schemes – DWP will launch a consultation this winter on the appropriate regime under which surpluses can be repaid and enabling 100% PPF coverage for DB schemes that opt to pay a higher levy. The authorised surplus payments charge will be reduced from 35% to 25% from 6 April 2024.

Local Government Pension Scheme: Investment reform consultation response – Following consultation, the government confirms that Local Government Pension Scheme (LGPS) guidance will be revised to implement a 10% allocation ambition for investments in private equity, which is estimated to unlock £25bn, as well as a March 2025 deadline for the accelerated consolidation of LGPS assets into pools, and setting a direction towards fewer pools exceeding £50bn of assets under management.

Supporting the growth of the UK’s world leading financial services sector

Smarter Regulatory Framework programme – The government is pressing ahead with work to ensure the UK maintains its world-leading financial services regulatory environment. The government will deliver its commitment to make significant progress in building a Smarter Regulatory Framework, tailored to the UK, by the end of the year. This includes the upcoming laying of legislation to replace the current Prospectus, Securitisation and Data Reporting Services Regulation regimes.

Replacing the Securitisation Regulation – The government will lay a statutory instrument that will replace the retained EU law Securitisation Regulation with a new framework tailored to the UK. This takes forward certain reforms identified in the government’s 2021 Review of the Securitisation Regulation.

Replacing the Short Selling Regulation (SSR) – The government has published a draft statutory instrument setting out how it will replace the retained EU law short selling regulation, including aspects on sovereign debt, with a new framework tailored to the UK. The government will also shortly legislate to double the SSR reporting threshold, as announced at Mansion House.

Replacing the Data Reporting Services Regulation (DRSR) – The government will shortly lay a statutory instrument that will replace retained EU law in relation to Data Reporting Services Providers (DRSPs) with a new framework tailored to the UK. This delivers on the Edinburgh Reforms commitment to have a regulatory framework for a consolidated tape in place by 2024.

Investment Research Review – The government and the FCA are engaging with industry stakeholders to take forward the recommendations of the Investment Research Review. This will inform formal consultations in 2024.

UK Retail Disclosure Framework – The government has published a draft statutory instrument setting out how it will replace the retained EU law Packaged Retail and Insurance-based Investment Products (PRIIPs) Regulation with a new framework tailored to the UK. The accompanying policy note confirms the scope of the new framework, including its application to overseas funds, and sets out the government’s intention to fully resolve legislative issues with cost disclosure.

Prospectus reform – The government will shortly lay a statutory instrument to replace the retained EU law prospectus regime with a new framework tailored to the UK. This will create a more agile and simplified regime, helping to widen participation in the ownership of public companies, simplify the capital-raising process for companies on UK markets, and make the UK a more attractive listing destination.

Future of Payments Review – The government welcomes the publication of Joe Garner’s Future of Payments Review. The government will repeal prescriptive EU-derived payments authentication rules and will also legislate to unlock the full potential of Open Banking-enabled payments. Next year, the government will publish a National Payments Vision.

Digital Securities Sandbox – The government will publish a response to the consultation on the Digital Securities Sandbox (DSS), which will facilitate the adoption of digital assets across financial markets. The government will also lay an SI to implement the DSS, delivering on the Edinburgh Reform announcement to implement a Financial Market Infrastructure Sandbox in 2023.

Consultation on introducing a UK regime for captive insurance companies – The government will consult on the design of a new framework for encouraging the establishment and growth of captive insurance companies in the UK. The consultation will launch in Spring 2024.

Mortgage Guarantee Scheme extension – The Mortgage Guarantee Scheme supports the availability of 95% Loan-to-Value mortgage products. While the scheme was due to close to new accounts on 31 December 2023, the Government will extend the scheme for an additional 18 months until the end of June 2025 to continue helping prospective borrowers with smaller deposits buy a home.

NatWest shareholding – The government intends to fully exit its shareholding in NatWest Group by 2025-26, subject to supportive market conditions and sales representing value for money. As part of this process, the government will explore options to launch a share sale to retail investors in the next 12 months, subject to supportive market conditions and achieving value for money.

UK Asset Resolution (UKAR) Pension Schemes Transfer – Continuing progress towards winding down the UKAR interventions, the government expects the transfer of the former Northern Rock Asset Management and Bradford & Bingley pension schemes to central government to occur in 2025-26.

Corporate Governance Reform – The government has written to the Financial Reporting Council (FRC) to update its remit, emphasising the role the FRC should play in promoting growth and competitiveness. [footnote 181] The government welcomes the Capital Markets Industry Taskforce work to reset culture through an “investor covenant” and the commitment from industry to provide additional funding to the Investor Forum. [footnote 182]

Supporting our scientists and innovators

Extension to Future Fund: Breakthrough – The government will provide at least £50 million of additional funding to the Future Fund: Breakthrough investment programme, helping the UK’s most intensive R&D companies to scale up.

Venture capital fellowship scheme – The government will develop a fellowship course targeting mid-career science and technology venture capital investors, similar to the Kauffman Fellowship in the US, to be operational in 2024. This will produce the next generation of world-leading UK VC investors to support the UK’s most innovative high-growth companies.

Youth Mobility Schemes – The government is signing and expanding new and existing Youth Mobility Schemes to improve UK and overseas nationals’ opportunities to live, work, and travel in each other’s countries.

Pro-Innovation Regulation of Technologies Review: Cross Cutting and Growth Duty – The government is publishing Professor Dame Angela McLean’s final report in this series and the government response, accepting recommendations to encourage pro-innovation regulation in all sectors.

New regulatory sandboxes – The government will establish new regulatory sandboxes for spectrum sharing, engineering biology, and space to help support innovation in these areas.

Government response to independent review of spin-outs – The government has published its response to the independent review of spin-outs, and has accepted all the recommendations, which will improve the ecosystem of support for university spin-out companies. The government is also introducing a new £20 million cross-disciplinary proof-of-concept research fund, which will help prospective founders in universities demonstrate the commercial potential of their research.

Quantum Missions – The government has published a set of quantum missions that will be delivered over the next decade.

Space Clusters and Infrastructure Fund – The government is awarding up to £59 million to 15 projects, which will leverage significant additional private funding from the sector, representing an expected £100 million of new private / public investment in space research and development infrastructure.

Connectivity in Low Earth Orbit (CLEO) R&D programme – The government is opening £15 million of calls to nurture innovation for satellite communications which will be delivered as part of the £60 million European Space Agency Advanced Research in Telecommunications Systems (ARTES) programme, allocated to the UK’s CLEO scheme.

Earth observation package – The government is investing £47 million in the earth observation sector, which will enable the UK industry to make better use of Earth Observation data for climate science and to develop innovative products and services.

National Academy for mathematical sciences – The government will support the establishment of a National Academy focused on Mathematical Sciences.

R&D infrastructure investment – The government will invest £25 million in scientific infrastructure through Public Sector Research Establishments.

Business innovation support – The government will invest £145 million through Innovate UK to support business innovation. This includes £20 million for productivity and decarbonisation of foundation industries, £50 million for battery innovation, £50 million for investment in Catapults, and £25 million for innovation in critical technologies.

Discovery Fellowships – The government aims to invest £250 million in new fellowships for world-class mid-career researchers. To maximise flexibility and test new funding models, it is exploring funding this through an endowment.

Response to the Landscape Review – The government is publishing its vision for evolving the landscape of organisations performing research, development and innovation, informed by the Review of the RDI organisational landscape led by Sir Paul Nurse.

Business visitor visa reform – The government will expand the business visitor rules to allow businesspeople to engage in a wider range of permitted activities and paid engagements, to take effect from January 2024. The government will also explore further reforms to the business visitor rules, during 2024.

Payment and Cashflow Review – The government has published its Payment and Cash Flow Review Report and responses to the consultation on the Payment Practices and Performance Regulations 2017 and the statutory review of the Small Business Commissioner. These publications outline measures to combat late payments.

Government Procurement and Prompt Payment – To encourage prompt payments, the government will introduce a requirement that firms bidding for government contracts over £5 million from April 2024 will have to demonstrate they pay their own invoices within an average of 55 days, tightening to 45 days in April 2025, and to 30 days in the coming years.

Made Smarter – The government will expand the Made Smarter Adoption programme, committing up to £16 million in 2025-26 to offer the scheme to all English regions before working with the devolved administrations to explore expanding the programme from 2026-27. The programme supports manufacturing SMEs to use advanced digital technologies, and expansion will also involve inclusion of digital internships in the programme.

UK Export Finance SME Support – The government will offer additional support to SMEs to access global markets through UK Export Finance including reviewing the products available for SMEs and enhancing the SME-focused support that is offered.

Help to Grow – The government will commit to future delivery of the Help to Grow: Management programme beyond 2024-25, providing training to SME leaders.

Growth Hubs – The government will commit to funding for Growth Hubs in 2024-25, delivering local business advice and support.

Digital Adoption – The government will set up a taskforce with industry to rapidly explore how best to support SMEs to adopt digital technology to improve their productivity.

Investing in key sectors

Landfill Remediation Pathfinder – The government is launching a £78 million competitive pilot fund to alleviate the cost of landfill tax where it is acting as a barrier to the remediation and redevelopment of contaminated land.

Future Climate Change Agreement scheme – The government is introducing a new, six-year Climate Change Agreement scheme. Participants that meet agreed energy efficiency or decarbonisation targets between 2025 and 2030 will be entitled to reduced rates of Climate Change Levy from 1 July 2027 to 31 March 2033. The new scheme will be open to applications for new sectors that meet energy intensity and import penetration criteria, and will require more regular reporting of energy and throughput data.

Climate Change Levy Rates 2025-26. The government will freeze main and reduced rates of Climate Change Levy in the UK in 2025-26 at the main rate of £0.00775/kWh for electricity and gas, £0.02175/kWh for liquid petroleum gas (LPG), and £0.06064/kWh for any other taxable commodity. Reduced rates will be frozen at 92% for electricity, 77% for LPG, and 89% for gas and any other taxable commodity.

Reforms to Energy-Saving Materials VAT Relief – Following a call for evidence, the government will expand the VAT relief available on the installation of energy-saving materials by extending the relief to additional technologies – such as water-source heat pumps – and bringing buildings used solely for a relevant charitable purpose within scope. Thanks to the Windsor Framework, these reforms will be implemented UK-wide in February 2024. Full details on these reforms will be published shortly.

Crown Estate modernisation – The government will bring forward legislation to provide The Crown Estate with borrowing and wider investment powers as soon as parliamentary time allows.

Carbon price support review and 2025-26 rates – The government will maintain Carbon Price Support (CPS) rates in Great Britain at a level equivalent to £18 per tonne of carbon dioxide in 2025-26. The government will continue to engage with industry and review CPS beyond the announced rates.

Oil and Gas Fiscal Regime – The government has announced an oil and gas fiscal regime package covering the short, medium- and long-term. The government has published a Technical Note and Summary of Responses from the Energy Profits Levy (EPL) Energy Security Investment Mechanism (ESIM) discussion note. In addition to restating that the EPL will end no later than 31 March 2028, these confirm that the EPL ESIM will be monitored monthly and that the price thresholds of the mechanism will be adjusted annually in line with CPI from April 2024. The government will introduce legislation to give effect to the ESIM in due course. The government has also published its conclusions to the review of the long-term oil and gas fiscal regime. This includes setting out principles for the tax treatment of future oil and gas price shocks after the end of EPL and targeted support for the energy transition through allowing relief for payments made by oil and gas companies into decommissioning funds in relation to oil and gas assets that are repurposed for use in Carbon Capture Usage and Storage instead of being decommissioned after their productive life in upstream projects. Legislation will also remove the receipts from the sale of these assets from the EPL.

Plastic Packaging Tax – The government will legislate in the Autumn Finance Bill 2023 to increase the Plastic Packaging Tax rate in line with CPI, from 1 April 2024, to £217.85 per tonne. To ensure the Plastic Packaging Tax continues to incentivise the use of recycled plastic in packaging, the government will publish an evaluation plan by the end of the year and gather further evidence to inform the future trajectory of the rate and recycled plastic content threshold.

Aggregates Levy Rate – The government will increase the Aggregates Levy rate in line with RPI, from 1 April 2025 to £2.08 per tonne.

Emissions Trading Scheme – Reforms to the ETS, as set out by the UK ETS Authority in July 2023, will reduce the number of ETS permits available for purchase from government by 45% between 2023 and 2027. It will also extend the scheme to cover emissions from domestic maritime and energy from waste in 2026 and 2028 respectively.

Manufacturing Funding – Funding of £4.5 billion will be made available starting in 2025-26 lasting for five years for eight manufacturing sub-sectors: automotive (particularly zero emission vehicles, their batteries and supply chains), aerospace, life sciences, and clean energy (carbon capture, utilisation and storage, electricity networks, hydrogen, nuclear and offshore wind).

Pro-Innovation Regulation of Technologies Review: Advanced Manufacturing – The government is publishing Professor Dame Angela McLean’s review on pro-innovation regulation of technologies for advanced manufacturing and the government response. This is the fifth report in the series commissioned at Autumn Statement 2022. The government’s response accepts Dame Angela’s recommendations and sets out how these will be implemented.

Clinical Trials Delivery Accelerator (Dementia) – The government is launching the first Clinical Trials Delivery Accelerator (CTDA) focused on dementia, with up to £20 million of the £121 million funding announced for clinical trials at the May life sciences moment, to help innovation reach NHS patients even faster.

Oligonucleotide Manufacturing Centre of Excellence (OMICE) – The government is investing £10 million, with an additional £10 million from Scottish Enterprise, in a world-class manufacturing centre in Paisley, Scotland, to develop a novel class of therapeutic molecules to be used for the treatment of a wide variety of diseases.

Fleming Centre – The government is granting £5 million to support establishment of the Fleming Centre to tackle the global fight against antimicrobial resistance (AMR).

Our Future Health – The government is providing £51 million to the UK’s largest health research proramme to recruit hundreds of thousands of new volunteers and genotype the first 1 million participants.

Creative Industries: call for evidence on the visual effects industry – The government has published a call for evidence on recent trends in the visual effects industry. This will inform the design of additional tax relief for expenditure on visual effects, which the government intends to deliver through the Audio-Visual Expenditure Credit. The government intends to consult on the detailed policy design of further support and intends to implement changes to the expenditure credit from April 2025.

Extension of uplifted relief for animated TV to include animation film – As previously announced, animated feature film will be eligible for a 5% uplift in relief under the Audio-Visual Expenditure Credit.

High-end TV relief: amending documentary definition – The government has amended the proposed definition of a documentary. The new definition is aligned with the guidance used by the British Film Institute and will apply to the Audio-Visual Expenditure Credit, which will be legislated for in the Autumn Finance Bill 2023.

Amendment to rules for connected party transactions in creative industry tax reliefs – The proposal to cap the relief that companies can receive on connected party transactions has been amended. Companies will now be required to disclose connected party transactions and charge connected parties at an arm’s length price. This will be legislated in the Autumn Finance Bill 2023.

Creative Industries – the government will provide £2.1 million of new funding for the British Film Commission and the British Film Institute Certification Unit for 2024/25. The government will also review the evidence on public investment in R&D spending for the creative industries to a Spending Review timeframe.

Increasing investment in UK research and innovation – The Prime Minister has negotiated excellent terms for the UK to associate to Horizon Europe and Copernicus. As a result, the government is making additional substantive investment in UK R&D this financial year. This includes Green Futures Fellowships, the Isambard supercomputer, Discovery Fellowships, business innovation support, Our Future Health, R&D infrastructure investment, and support to establish a National Academy focused on Mathematical Sciences.

Lord Harrington Review of Foreign Direct Investment – The government agrees in principle with Lord Harrington’s headline recommendations and will establish a new Ministerial Investment Group, review investment grant processes, and increase resourcing for the Office for Investment, strengthening the UK’s world-class concierge service for investors.

Connected and Automated Mobility funding – The government has committed to extend the Connected and Automated Mobility R&D programme with up to £150 million of funding between 2025-26 and 2029-30, helping the UK secure first-mover advantage in the deployment of self-driving vehicles and services.

5G Innovation Regions – The government is announcing the ten regions that have been awarded funding to establish themselves as 5G Innovation Regions following a competition for the £40 million adoption fund. This will support regions to drive take up of innovative 5G-enabled services for businesses and the public sector.

AI Compute – Investing £500 million in further UK based compute so that universities, scientists and start-ups have access to the compute power they need to help make the UK an AI powerhouse.

Rare Diseases Launchpad – The government is supporting a pilot developed by a consortium including Genomics England, Oxford Harrington Rare Disease Centre, the Medicines and Healthcare products Regulatory Agency, and Mila’s Miracle Foundation to generate evidence on a pathway for new individualised therapeutics in the UK for children with ultra-rare diseases.

New devolution deals – The government has finalised four new devolution deals across England. This includes two Level 3 mayoral deals with Greater Lincolnshire, and Hull and East Yorkshire and two Level 2 non-mayoral deals with Lancashire and Cornwall. The government is also in advanced discussions to agree a Level 2 non-mayoral deal with Devon and Torbay.

Extension of Level 2 devolution deals – The Department for Levelling Up, Housing and Communities intends to offer Level 2 devolution powers to councils that cover a functional economic or whole county area, and meet relevant criteria as set out in the Levelling Up White Paper, where there is local consent to such arrangements.

Single Settlements Memorandum of Understanding – At Spring Budget 2023 the government announced two new trailblazer deals with West Midlands Combined Authority (WMCA) and Greater Manchester Combined Authority (GMCA). This included a commitment to provide flexible, single funding settlements for these MCAs at the next Spending Review. The government has published a Memorandum of Understanding (MoU) for these single settlements. The MoU sets out how the government will operationalise these single funding settlements for the GMCA and WMCA.

Business rates retention – the government has agreed the detailed terms of the long-term business rates retention arrangements for the Greater Manchester and West Midlands Combined Authorities, delivering on the commitment in the trailblazer deals announced at Spring Budget 2023. These arrangements will commence from April 2024.

Level 4 framework – The government has published a new framework for extending deeper devolution to existing Level 3 Mayoral Combined Authorities (MCAs). The Level 4 framework provides new powers for MCAs to draw down on, based on the trailblazer deals negotiated with the Greater Manchester and West Midlands Combined Authorities, including powers over adult skills, local transport and housing.

Levelling Up Partnerships (LUPs) extension to Scotland – The government, in collaboration with the Scottish Government, is announcing over £80 million of investment for the expansion of the Levelling Up Partnerships programme to Scotland, for Na h-Eileanan an lar, Argyll and Bute, Dundee, and the Scottish Borders. The government will consider, as the programme develops, how to extend it further.

Additional regeneration projects – In addition to the recently announced Levelling Up Fund Round Three projects, the government is announcing £37.5 million to support regeneration in places across the UK. These are: the Isles of Scilly, Warrington, Monmouthshire, North Norfolk and Eden. All funding is subject to final checks, including subsidy control. Bolsover will also receive £15 million, ensuring that all Priority Places, as determined using the Levelling Up Need metrics set out in the Levelling Up White Paper, have benefited from levelling up funding. The government will also support the Hay Festival in Wales, and the reallocation of £20 million from within the Inverness & Highland City Region Deal to fund essential landside infrastructure improvements for the Corran Ferry, subject to agreement through the appropriate Deal governance structures. This will ensure the long-term sustainability of the lifeline service.

Barrow Delivery Board – The government is announcing a new Delivery Board in Barrow-in-Furness, backed by £5 million of funding, to ensure local people see lasting benefits from investment in the Defence Nuclear Enterprise.

Fund Simplification Implementation – The recently announced funding simplification doctrine will come into force from January 2024. This is an important step to simplifying the local government funding landscape, giving councils greater flexibility and freeing up resources for delivery.

Local Finance Working Group – The Department for Levelling Up, Housing and Communities will work with the UK Infrastructure Bank, the British Business Bank, Homes England and other departments to consider – with local and private sector partners – how to support levelling up through improving access to finance. The group will report to Ministers by the spring.

Investment Zones Programme Extension – The Investment Zones programme in England will be extended from five to ten years. Investment Zones will be provided with a £160 million envelope from 2024-25 to 2033-34 which can be used flexibly between spending and tax incentives, subject to ongoing co-design of proposals and agreement of delivery plans. The UK government will work in partnership with the Scottish and Welsh governments with the intention of delivering an extension to the Investment Zones programme in Scotland and Wales and continue to work with stakeholders on how best to deliver the benefits of the Investment Zones programme in Northern Ireland.

Announcing Investment Zones – Greater Manchester’s Investment Zone will focus on advanced manufacturing and materials across Manchester, Salford, Rochdale, Bury, Oldham and the wider city region, with anchor investment from First Graphene, Kadant, Werit and Hydrograph worth over £10 million. West Midlands’ Investment Zone will focus on advanced manufacturing across Birmingham, Wolverhampton and Coventry, with benefits felt across the wider region, with anchor investment from Bruntwood SciTech and Woodbourne Group worth £70 million in total and backed by over £5 million of investment into enabling digital platforms to support advanced manufacturing growth. East Midlands’ Investment Zone will focus on advanced manufacturing and green industries across Nottinghamshire, Derby and Derbyshire with benefits felt across the wider region, with anchor investment from Rolls Royce and Laing O’Rourke worth £9.3 million. In addition to this, the government can confirm there will be two Investment Zones in Wales; one located across Cardiff and Newport, delivered by the South East Wales Corporate Joint Committee and another focusing on Wrexham and Flintshire delivered by the North Wales Corporate Joint Committee. The government will be working closely with the Welsh Government on the delivery of these Investment Zones.

Investment Opportunity Fund – The government is creating a £150 million fund to support Investment Zones and Freeports across the UK to secure business investment opportunities. The fund will be available over five years.

Freeport Tax Relief Sunset Date Extension – The window to claim Freeport tax reliefs will be extended from five to ten years, until September 2031 in English Freeports, conditional on agreement of delivery plans with each Freeport. The UK Government will work with the devolved administrations to agree how the 10-year window to claim reliefs can be extended to Freeports in Scotland and Wales.

Freeports Delivery Roadmap – The Department for Levelling Up, Housing and Communities will publish a Freeports Delivery Roadmap in December outlining the steps the government will take to ensure Freeports are best able to capitalise on the opportunity the extension presents.

Tackling Paramilitarism Programme – The government is confirming the allocation of £3 million for the Tackling Paramilitarism Programme in Northern Ireland, enabling the programme to continue its positive work to tackle paramilitarism in Northern Ireland and strengthen community resilience.

Cambridge, Leeds and London – The government is announcing a further £2 million to address water scarcity in Cambridge, alongside £3 million to support the Cambridge Delivery Group drive the long-term vision for Cambridge by exploring the case for a development corporation. An additional £2 million in capacity funding will also be available for Leeds City Council to maximise delivery of new homes. Subject to business case approval, the government will also provide £23 million for a bus network to unlock housing in the ‘Docklands 2.0’ as part of the £150 million allocation to London from the Brownfield, Infrastructure and Land Fund.

Planning capacity funding – The government is investing £5 million in additional funding for DLUHC’s Planning Skills Delivery Fund for Local Planning Authorities to target application backlogs.

Local Nutrient Mitigation Fund – The government is providing £110 million of funding to support Local Planning Authorities to deliver high quality schemes to offset nutrient pollution, unlocking planning permissions that are otherwise stalled.

Affordable Homes Guarantee Scheme – The government is expanding the existing £3 billion scheme by a further £3 billion to support housing associations to access cheaper loans for quality and energy efficiency works as well as new homes.

Housing Revenue Account rate extension – The government is announcing a £5 million extension to June 2025 of the Public Works Loan Board policy margin announced in Spring 2023. This supports local authorities borrowing for Housing Revenue Accounts, and could provide savings and additional investment in social housing of as much as £150 million over the life of the borrowing.

Home buying and selling – The government is providing £3 million for a range of measures to improve the home buying and selling process, including pilots to develop property tech products and to digitise local council property data.

Local Authority Housing Fund 3 – The government is announcing £450 million for a third round of the Local Authority Housing Fund to deliver 2,400 new housing units to house Afghan refugees and ease wider housing and homelessness pressures. This will bring the total amount spent on the Local Authority Housing Fund to over £1.2 billion.

Homes for Ukraine and homelessness prevention – The government will extend ‘thank you’ payments into a third year for Homes for Ukraine sponsors across the UK. They will remain at £500 per month and reflect the ongoing generosity of hosts in supporting those who have fled the war. The government is also providing £120 million funding for the devolved administrations and local authorities in England to invest in homelessness prevention, including to support Ukrainian households who can no longer remain in sponsorship.

Permitted Development Right convert one house into two flats – The government is announcing a consultation on a new Permitted Development Right for subdividing houses into two flats without changing the façade. This will be implemented in 2024 following consultation early in the New Year.

This annex sets out the revision to the government’s financing plans for 2023-24, which were previously revised on 25 April 2023. [footnote 183] Further details of the revised financing remit for 2023-24, including progress against the remit to date, can be found on the website of the UK Debt Management Office (DMO). [footnote 184] The government’s debt management framework remains as set out in the ‘Debt management report 2023-24’. [footnote 185]

Debt management objective

The debt management objective, as set out in the ‘Debt management report 2023-24’, is “to minimise, over the long term, the costs of meeting the government’s financing needs, taking into account risk, while ensuring that debt management policy is consistent with the aims of monetary policy.”

Debt management policy

While decisions on debt management policy must be taken with a long-term perspective, specific decisions on funding the government’s gross financing requirement are taken annually. Those decisions are announced in advance of the forthcoming financial year and are typically updated in April (a technical adjustment to reflect outturn data from the previous year) and as the Office for Budget Responsibility (OBR) publishes subsequent fiscal projections.

Financing arithmetic

The updated financing arithmetic for 2023-24 is set out in Table A.1.

The OBR’s November 2023 forecast for the 2023-24 central government net cash requirement (excluding NRAM ltd, Bradford & Bingley, and Network Rail), which is referred to as CGNCR (ex NRAM, B&B, and NR) is £150.5 billion, which represents a downward revision of £9.0 billion from Spring Budget 2023. This measure is used in the financing arithmetic, as it reflects the forecast cash requirement of the Exchequer.

The DMO’s net financing requirement (NFR) was revised down by £3.3 billion on 25 April 2023 from £246.1 billion at Spring Budget 2023. The DMO’s NFR is being revised down by a further £10.5 billion at the Autumn Statement. The updated forecast for the NFR comprises: CGNCR (ex NRAM, B&B, and NR), plus financing for maturing debt, and a reconciling adjustment due to unanticipated over financing in 2022-23; less the net contribution to financing from National Savings and Investments (NS&I) and any other ad hoc in-year contributions to financing. The downward revision to the DMO’s NFR will be delivered through: a reduction in gross gilt issuance this year of £0.5 billion; and a £10.0 billion reduction in the financing raised through Treasury bill issuance for debt management purposes.

Table A.1: Financing arithmetic in 2023-24 (£ billion)(1)

Gilt issuance by method, type and maturity.

The method, type and maturity of gilt issuance were previously set out in April 2023. Total gilt sales in 2023-24 are now forecast to reduce by £0.5 billion to £237.3 billion.

The decrease in gilt sales of £0.5 billion will be implemented as follows:

• An increase of £2.0 billion in short-dated conventional gilts to £86.6 billion (36.5% of total issuance in 2023-24)
• An increase of £3.0 billion in medium-dated conventional gilts to £68.3 billion (28.8% of total issuance in 2023-24)
• An increase of £1.6 billion in long-dated conventional gilts to £51.3 billion (21.6% of total issuance in 2023-24)
• An increase of £2.4 billion in index-linked gilts to £28.6 billion (12.1% of total issuance in 2023-24)
• A reduction of £9.5 billion in the unallocated portion to £2.5 billion. Since April 2023, the unallocated portion has been drawn-down via transfers to the medium and long conventional and index-linked gilt sales programmes.

Auctions will remain the government’s primary method of gilt issuance. It is anticipated that £203.1 billion (85.6%) of total gilt sales will be sold by auction in 2023-24, and £31.4 billion (13.2%) will be issued by syndication.

Green gilts and green retail savings product

Since Spring Budget 2023, the government has made strong progress with its green financing programme, under which the UK issues sovereign green bonds (‘green gilts’) via the DMO, and retail Green Savings Bonds via NS&I. The government aims to raise £10.0 billion via green gilts this financial year.

The UK successfully launched its inaugural green gilt maturing in 2033 on 21 September 2021, followed by a second green gilt, maturing in 2053 on 21 October 2021, bringing total proceeds raised by both issues to £16.1 billion. In FY 2022-23, a further £9.9 billion was raised by reopening the existing green gilts.

The retail Green Savings Bonds were brought on sale via the NS&I website on 22 October 2021. The retail Green Savings Bonds are a 3-year fixed-term product, with the current sixth issue of the product offering an interest rate of 3.95%. Customers can invest between £100 and £100,000. A world-first sovereign retail green investment product, this innovative financing instrument will allow UK savers to support the government’s green spending initiatives.

Treasury bills

Treasury bills for debt management purposes comprised £70.0 billion of the total debt stock at the end of 2022-23. It was anticipated at Spring Budget 2023 that net issuance of Treasury bills for debt management purposes in 2023-24 would contribute £5.0 billion to meeting the NFR. It is now planned for net issuance to make a contribution of -£5.0 billion.

NS&I’s net financing target in 2023-24 remains at £7.5 billion, within a range of ± £3.0 billion, as set out at Spring Budget 2023. This target reflects NS&I’s requirement to balance the interests of its savers, the taxpayer, and the wider financial services sector. The proceeds from the sale of the retail Green Savings Bonds do not form part of the annual net financing target. They will be reported as part of the financing arithmetic before the financial year-end.

Illustrative future gross financing requirement

Table A.2 sets out the illustrative gross financing requirement for each financial year from 2024-25 to 2028-29, using the OBR’s November 2023 forecast for CGNCR (ex NRAM, B&B, and NR) and taking into account current planned gilt redemptions.

Table A.2: Illustrative gross financing requirement (£ billion)(1)

‘Economic and Fiscal Outlook’ , Office for Budget Responsibility, November 2023.  ↩

‘Consumer price inflation, UK’ , Office for National Statistics, October 2023. Details of numerical references, including National Statistics, used in this chapter can be found in ‘Autumn Statement 2023 data sources’.  ↩

‘Spring Budget’ , HM Treasury, March 2023.  ↩

‘Forecast Evaluation Report’ , Office for Budget Responsibility, October 2023.  ↩

‘Report on Jobs’ , KPMG and REC, November 2023.  ↩

‘Using administrative data to create headline labour market figures’ , Office for National Statistics, November 2023.  ↩

‘Labour force survey: planned improvements and its reintroduction’ , Office for National Statistics, November 2023.  ↩

‘Monetary Policy Report’ , Bank of England, November 2023.  ↩

‘Key ECB interest rates’ , European Central Bank, September 2023.  ↩

‘Open market operations’ , Federal Reserve Board, July 2023.  ↩

‘Fiscal Monitor’ , International Monetary Fund, October 2023. Data uses general government metrics and, unlike the OBR, makes specific judgements of the likelihood of future tax and spend policy, meaning figures differ. Data from the IMF are taken on a calendar year whereas the OBR’s forecasts are presented on a financial year basis.  ↩

‘Fiscal Monitor’ , International Monetary Fund, October 2023.  ↩

‘France, 2022 Article IV Consultation’ , International Monetary Fund, January 2023.  ↩

‘Germany’s federal debt rule’ , Federal Ministry of Finance, February 2022.  ↩

‘Stability and Growth Pact’ , European Commission, October 2021.  ↩

‘2023 Budget’ , Government of Canada, March 2023.  ↩

‘Fiscal overview’, Parliament of Australia, April 2022.   ↩

‘Government Response to the 2023 Fiscal Risks and Sustainability Report’ , HM Treasury, November 2023.  ↩

‘Annual Report on the UK Government’s Contingent Liabilities’ , HM Treasury, November 2023.  ↩

‘Economic and Fiscal Outlook’ , Office for Budget Responsibility, October 2022.  ↩

‘The Charter for Budget Responsibility’ , HM Treasury, January 2023.  ↩

‘Public Sector Finances’ , Office for National Statistics, October 2023.  ↩

‘Economic and Fiscal Outlook’ , Office for Budget Responsibility, March 2023.  ↩

‘A long unwinding road, OECD economic outlook’ , Organisation for Economic Co-operation and Development, June 2023.  ↩

‘Quasi Fiscal Implications of Central Bank Crisis Intervention’ , International Monetary Fund, June 2023.  ↩

Changes to the core schools budget since Autumn Budget and Spending Review 2021 as a result of uplifts announced at Autumn Statement 2022 and alongside the July 2023 teacher pay award .  ↩

Record funding for schools in England , Department for Education, July 2023.  ↩

Spring Budget 2023 , HM Treasury, March 2023.  ↩

PM announces further £1 billion in military support to Ukraine , Prime Minister’s Office, 10 Downing Street, Ministry of Defence, June 2022; UK will match record Ukraine support in 2023 , Prime Minister’s Office, 10 Downing Street, September 2022.  ↩

Global businesses pledge to back Ukraine’s recovery as PM sets out major financial package , Prime Minister’s Office, 10 Downing Steet, Foreign, Commonwealth & Development Office, June 2023.  ↩

HMT calculations based on Autumn Statement 2023 HMT DEL plans and OBR Economic and Fiscal Outlook - November 2023.   ↩

Autumn Budget and Spending Review 2021 , HM Treasury, October 2021, page 49.  ↩

Government Efficiency Savings 2021/22 , Cabinet Office, July 2023.  ↩

Cabinet Office calculations based on progress of property sales programme so far.  ↩

Speech: Skills, Efficiency and Technology in the Civil Service, Cabinet Office , July 2023.  ↩

GOV.UK One Login: 1.5 million people already benefiting from reform of government services online , Cabinet Office, Government Digital Service, July 2023.  ↩

Speech: Skills, Efficiency and Technology in the Civil Service , Cabinet Office, July 2023.  ↩

New counter fraud authority saves taxpayers £311 million in its first year, beating target by more than £100 million , Cabinet Office, Public Sector Fraud Authority, September 2023.  ↩

The Government Efficiency Framework , HM Treasury, July 2023.  ↩

Annual Reports and Accounts 2021-22 , Department of Health and Social Care, January 2023.  ↩

Government and health unions agree pay deal paving way for an end to strike action , Department of Health and Social Care, March 2023.  ↩

Prime Minister to create ‘smokefree generation’ by ending cigarette sales to those born on or after 1 January 2009 , Prime Minister’s Office, 10 Downing Street, October 2023.  ↩

NHS Long Term Workforce Plan , NHS England, June 2023.  ↩

Public Service Pensions: SCAPE discount rate , HM Treasury, March 2023.  ↩

Occupied Palestinian Territories: Humanitarian Situation , Hansard, November 2023.  ↩

Extra £20 million in humanitarian aid doubles UK support to Palestinian civilians , Foreign, Commonwealth & Development Office, Prime Minister’s Office, 10 Downing Street, October 2023.  ↩

As set out in the Written Ministerial Statement on 27 April on Northern Ireland Finances 2023-24, Barnett consequentials for 2023-24 will be used to repay the £297 million Northern Ireland Executive overspend from 2022-23. Details will be confirmed at Supplementary Estimates 2023-24.  ↩

Policing Productivity Review , Home Office, November 2023.  ↩

According to the latest ONS official statistics on public sector employment in the UK , there were 457k FTE in June 2023, compared to 391k in March 2019, excluding devolved administrations. If the size of the civil service remained at June 2023 levels, instead of increasing at the average 2016-2023 growth rate, up to £1bn could be saved by March 2025.  ↩

Shared Outcomes Fund Round Three , HM Treasury, November 2023.  ↩

Public service productivity, UK: 1997 to 2022 , ONS, November 2023.  ↩

HMT analysis of fiscal event documentation since 2016.  ↩

Tax Structure and Parameters statistics, HM Revenue and Customs, June 2022. HMRC analysis of NICs liabilities. Economic and Fiscal Outlook, Office for Budget Responsibility, November 2023.   ↩

Annual Survey of Hours and Earnings, Office for National Statistics, November 2023. HM Revenue and Customs analysis of NICs liabilities.  ↩

HM Revenue and Customs analysis of NICs liabilities.  ↩

Tax Structure and Parameters statistics, HM Revenue and Customs, June 2022.   ↩

Annual Survey of Hours and Earnings, Office for National Statistics, November 2023.   ↩

School workforce in England survey, June 2023.   ↩

NHS Staff Earnings Estimates, NHS, June 2023.   ↩

HM Revenue and Customs analysis of NICs liabilities. Annual Survey of Hours and Earnings, Office for National Statistics, November 2023.   ↩

Organisation for Economic Cooperation and Development (OECD), April 2023.   ↩

Policy Measures Database, Office for Budget Responsibility, October 2023.  ↩

This is based on the assumption that a full-time worker on the NLW works 35 hours a week, 52 weeks a year.  ↩

Department for Business and Trade calculations – for further details see Data Sources.  ↩

Short-Term Labour Market Statistics: Employment Rates (Database) , OECD, 2023.  ↩

Short-Term Labour Market Statistics: Inactivity Rates (Database) , OECD, 2023.  ↩

Rising ill-health and economic inactivity because of long-term sickness, UK – Office for National Statistics (ons.gov.uk) , Office for National Statistics, 2023.  ↩

Fiscal Sustainability and Risks Report , Office for Budget Responsibility, 2023.  ↩

UK Labour Market: November 2023, Office for National Statistics, 2023 .  ↩

Department for Work and Pensions, UC Health Caseload and Employment and Support Allowance Support Group Caseload, Stat X-plore , May 2019 and February 2023.  ↩

Economic and Fiscal Outlook – March 2023 , Office for Budget Responsibility, 2023.  ↩

UK Labour Market: November 2023 ,Office for National Statistics, 2023  ↩

Unemployment by duration , OECD, 2022.  ↩

Which groups find it hardest to find a job following a period out of work? , Office for National Statistics, 2021.  ↩

Written statements – Written questions, answers and statements – UK Parliament , UK Parliament, February 2023.  ↩

Written statements – Written questions, answers and statements – UK Parliament , UK Parliament, September 2023.  ↩

Represents gross AME savings only. See scorecard for net savings figure.  ↩

Rising ill-health and economic inactivity because of long-term sickness, UK: 2019 to 2023 , Office for National Statistics, 2023.  ↩

Internal NHSE calculations using existing administrative data from the NHS Talking Therapies programme.  ↩

Work capability assessment activities and descriptors , Department for Work and Pensions, 2023.  ↩

The Stat-Xplore caseload is 2.46 million at May 2023, the forecast combined caseload is lower than this due to the removal of dual claims where individuals claim New Style ESA (alongside UC health or legacy ESA).  ↩

Economic and Fiscal outlook – November 2023, Office for Budget Responsibility, 22 November 2023   ↩

The employment of disabled people 2023 – GOV.UK (www.gov.uk) , Department for Work and Pensions, 2023.  ↩

Occupational Health: Working Better , Department for Work and Pensions, November 2023.  ↩

‘National fiscal policy responses to the energy crisis’ , Bruegel, 2023.  ↩

Written statements – Written questions, answers and statements – UK Parliament, UK Parliament , 2023.  ↩

Mortgage Charter – GOV.UK (www.gov.uk), September 2023.   ↩

Inflation and price indices: November 2023, (ons.gov.uk), Office for National Statistics, November 2023 .  ↩

Economic and Fiscal Outlook, Office for Budget Responsibility, November 2023.   ↩

Monetary Policy Report – November 2023 , Bank of England, November 2023. Family Spending in the UK: April 2021 to March 2022 , Office for National Statistics, May 2023.  ↩

Cost of Living Payments: Overview and FAQs , House of Commons Library, October 2023.  ↩

Department for Work and Pensions analysis (Ad hoc statistical analyses 2023) , Department for Work and Pensions, November 2023.  ↩

Average weekly earnings in Great Britain: November 2023 (ons.gov.uk), Office for National Statistics, November 2023.  ↩

The new full State Pension will increase from £203.85 per week in 2023-24 to £221.20 per week in 2024-25. This is an increase of £17.35 per week, or £902.20 a year, if a pensioner receives 52 weeks of State Pension.  ↩

Support figure includes raising the Local Housing Allowance, the Energy Price Guarantee, working age benefits uprating in April 2024 and April 2025, and further direct household support announced over Autumn Statement 2023, Spring Budget 2023, Autumn Statement 2022, May 2022 Package, Spring Statement 2022 and Autumn Budget 2021. Average support is calculated by dividing total support by the number of UK households (Office for National Statistics, May 2023).  ↩

HM Treasury calculations using quarterly national accounts data, Eikon Refinitiv, accessed 15 November 2023.  ↩

GDP Revision Triangles , real GDP Revisions, Office for National Statistics (ONS), September 2023.  ↩

CPI Inflation Time Series , CPI Inflation Annual rate, ONS, November 2023.  ↩

Economic and fiscal outlook , Office for Budget Responsibility, November 2023.  ↩

Annual national accounts, non-financial accounts by economic sector , average of 2012-2021, OECD Statistics, 2023.  ↩

HM Treasury analysis using GDP per hour worked data , OECD, 2023; Penn World Table v10.01 data on capital stocks, Human Capital index, and share of labour composition in GDP, January 2023.  ↩

Growth in gross fixed capital formation from Q1 2021 – Q2 2023 for G7 countries , OECD Investment (GFCF), 2023.  ↩

Economic and fiscal outlook , Office for Budget Responsibility, November 2023. The OBR account for the supply side impact of selected policy measures within their economic forecast where credible evidence suggests they are likely to have a material, additional and durable impact on potential output, as discussed in Dynamic scoring of policy measures in OBR forecasts , Office for Budget Responsibility, November 2023.  ↩

Patient Capital Review, Industry Panel Response , HM Government, October 2017; Supporting Innovative Start-Up and Growing Businesses: Equity Finance Provision through the Pandemic: Interim Report , Marek Kacer, Nick Wilson, September 2023; Business equity finance and the UK regions , Department for Business and Trade (DBT), July 2019.  ↩

Report on potential economic impacts of changes to the insurance regulatory framework in response to HM Treasury’s review of Solvency II and PRA Solvency II Reform Consultation Paper , KPMG, November 2023.  ↩

This estimate is based on internal government analysis that draws on public and proprietary information at a sectoral level, as provided by DBT, DESNZ, and the Office for Life Sciences. The approach takes the public spending amount by manufacturing sector, uses a ratio of gross private investment per pound of public spending and applies an additionality assumption to account for the fact that some of this investment would occur without government intervention.  ↩

Connections Action Plan , Department for Energy Security and Net Zero (DESNZ) and Ofgem, November 2023; Transmission Acceleration Action Plan , DESNZ, November 2023. A letter from the Energy Systems Catapult will be published on their website.  ↩

2024 Price Review: key facts and data from water company draft plans , Ofwat, October 2023. Estimated expenditure is set to increase from £11.8bn per year on average (£59bn, 2020-21 to 2024-25) to £19.2bn per year on average (£96bn, 2025-26 to 2029-30). This is c£7bn per year but will include expenditure other than business investment so we have assumed £6bn. These draft company plans and costs are subject to ongoing scrutiny by Ofwat.  ↩

See Box 2.2 Economic and fiscal outlook, Office for Budget Responsibility, March 2023 and Box 2.1 Economic and fiscal outlook, Office for Budget Responsibility, November 2023. The OBR estimate 110,000 additional people into employment from measures announced at Spring Budget 2023, and an additional 78,000 people into employment from measures announced in Autumn Statement 2023.  ↩

Appendices to Working Paper No. 471 The Bank of England’s forecasting platform: COMPASS, MAPS, EASE and the suite of model , page 64, Bank of England, May 2013.  ↩

On the basis of OECD 2023 figures taking into account national as well as sub-national rates.  ↩

OECD R&D Tax Incentives database , OECD, April 2023.  ↩

Policy Costings , Autumn Statement 2023.  ↩

Economic and fiscal outlook , Office for Budget Responsibility, November 2023. This is based on an established evidence base on the links between cost of capital (which includes capital allowances) and business investment.  ↩

Estimates based on internal HM Treasury modelling on total bill changes by sector and property type, including the effect of reliefs.  ↩

Small Business Rates Relief data, National Non-Domestic Relief (NNDR) return , Department for Levelling Up, Housing and Communities (DLUHC), 2023.  ↩

Business rates estimates based on DLUHC modelling using VOA data and National Non-Domestic Relief (NNDR) returns. Information on total rateable value by sector can be found from the Valuation Office Agency . HM Treasury analysis of potential benefit of full expensing to retail sector (SIC code G) using HM Revenue & Customs (HMRC) data on qualifying expenditure for capital allowances in Corporation Tax returns with accounting periods ending in 2021-22 by sector.  ↩

Based on analysis of HMRC tax administration data.  ↩

Delivering net zero, climate resilience and growth: Improving nationally significant infrastructure planning , National Infrastructure Commission, April 2023.  ↩

Nationally Significant Infrastructure: action plan for reforms to the planning process , DLUHC, February 2023.  ↩

Getting Great Britain building again: speeding up infrastructure delivery , DLUHC, November 2023.  ↩

Connections Action Plan , DESNZ and Ofgem, November 2023.  ↩

Transmission Acceleration Action Plan , DESNZ, November 2023.  ↩

The Second National Infrastructure Assessment, National Infrastructure Commission , October 2023.  ↩

Smarter regulation: strengthening the economic regulation of the energy, water and telecoms sectors , DBT, November 2023.  ↩

Smarter regulation: regulating for growth , DBT, November 2023.  ↩

Financial Reporting Council Remit , letter from Secretary of State for Business, November 2023.  ↩

Network North: Transforming British Transport , Department for Transport (DfT), October 2023.  ↩

Chancellor’s Mansion House speech , July 2023.  ↩

Evolving the regulatory approach to Master Trusts, Department for Work and Pensions (DWP), November 2023.   ↩

Trends in the defined contribution trust-based pensions market, DWP, November 2023.   ↩

HM Treasury calculations using modelling provided by the Government Actuary’s Department on the size of the LGPS, which is estimated to grow to around £500 billion of assets by 2030.   ↩

Investment Delivery Forum , July 2023.  ↩

Harrington Review of Foreign Direct Investment , HMT and DBT, November 2023.  ↩

HM Government’s response to Lord Harrington’s Review into the government’s approach to attracting foreign direct investment , HM Government, November 2023.  ↩

Enabling growth across the UK 2023: UK-based financial and related professional services , TheCityUK, 2023; State of the sector: annual review of UK financial services 2023 , The Global City, HM Treasury, 2023.  ↩

UK Listings Review , HM Treasury, November 2020; UK Secondary Capital Raising Review , HM Treasury, 2021; UK Investment Research Review, Rachel Kent, July 2023; Wholesale Markets Review Consultation Response , HM Treasury, March 2022.  ↩

Building a Smarter Financial Regulatory Framework for the UK, HM Treasury’s Plan for Delivery , HM Treasury, July 2023.  ↩

Future of Payments Review 2023 , HM Treasury, July 2023.  ↩

R&D tax expenditure and direct government funding of BERD , OECD Statistics, 2023.  ↩

Research, development and innovation (RDI) organisational landscape: an independent review , November 2023  ↩

Intellectual property, start-ups and spin-offs , HESA, April 2023.  ↩

Independent Review of University Spin-out Companies and HM Government response , November 2023.  ↩

National Quantum Strategy Long-Term Quantum Missions , Department for Science, Innovation and Technology (DSIT), November 2023.  ↩

Immigration Rules Appendix Youth Mobility Scheme: eligible nationals , Home Office, November 2023.  ↩

Business population estimates for the UK and regions 2023 statistical release , DBT, October 2023.  ↩

For example, Global Startup Ecosystem Index , Startup Blink, 2023  ↩

Powering Up Britain , DESNZ, 2023.  ↩

DESNZ analysis of the BloombergNEF, Energy transition investment dataset converting to 2022 prices, BNEF .  ↩

PRIMAP-hist. Historical emissions time series , United Nations Climate Change (UNCC), 2022.  ↩

Floating Offshore Wind in Wales , House of Commons Welsh Affairs Committee, 2023.  ↩

Business Enterprise Research & Development (BERD), UK: 2021 , ONS, November 2022.  ↩

Trade in goods: CPA (08) exports and imports , ONS, November 2023; Total Trade (TT): WW: Exports: BOP: CP: SA , ONS, November 2023.  ↩

JOBS02: Workforce jobs by industry , ONS, 2023.  ↩

JOBS05: Workforce jobs by region and industry , ONS, 2023; Regional gross disposable household income , UK, ONS, 2023.  ↩

Make UK – UK Manufacturing The Facts 2023 , Make UK, 2023.  ↩

Professor Dame Angela McLean’s review on pro-innovation regulation for advanced manufacturing and the government response , HM Treasury, November 2023.  ↩

Critical Minerals Refresh: Delivering Resilience in a Changing Global Environment , DBT, March 2023.  ↩

Internal DESNZ research;  Low carbon and renewable energy economy estimates , ONS, 2023;  UK trade: goods and services publication tables , ONS, November 2023.  ↩

CO2 Storage Evaluation Database (CO2 Stored). The UK’s online storage atlas , Bentham et al., 2014.  ↩

DCMS Sectors Economic Estimates: Monthly GVA (to September 2023) , DCMS, November 2023.  ↩

UK tech sector retains #1 spot in Europe and #3 in world as sector resilience brings continued growth , DCMS, December 2022.  ↩

AI investment forecast to approach $200 billion globally by 2025 , Goldman Sachs, August 2023.  ↩

UK unveils world-leading approach to innovation in first artificial intelligence white paper to turbocharge growth , DSIT, March 2023; DCMS and Digital Economic Estimates: Monthly GVA (to Sept 2023) , DCMS, DSIT, November 2023.  ↩

A pro-innovation approach to AI regulation , DSIT, Office for AI, March 2023.  ↩

Activity in the NHS , The King’s Fund, June 2023.  ↩

DCMS Economic Estimates 2019: GVA in individual DCMS sectors , DCMS, February 2021.  ↩

DCMS and Digital Economic Estimates: Monthly GVA (to Sept 2023) , DCMS, DSIT, November 2023.  ↩

HMRC Creative Industry statistics commentary : Creative industries tax reliefs, 2019-20 to 2021-22, HMRC, August 2023.  ↩

Skills and UK Productivity , Department for Education, 2023.  ↩

Apprenticeships and Traineeships , Department for Education, October 2023.  ↩

DLUHC internal estimates.  ↩

Financial Reporting Council Remit, Letter from Secretary of State for Business, November 2023 https://www.gov.uk/government/publications/financial-reporting-council-frc-remit-letter-from-business-secretary-november-2023  ↩

Capital Markets Industry Taskforce, Letter on Governance and Stewardship, November 2023 https://capitalmarketsindustrytaskforce.com  ↩

‘Revision to the DMO’s Financing Remit 2023-24’ , UK Debt Management Office, April 2023.  ↩

https://www.dmo.gov.uk.  ↩

‘Debt management report 2023-24’ , HM Treasury, March 2023.  ↩

Is this page useful?

• Yes this page is useful
• No this page is not useful

Help us improve GOV.UK

Don’t include personal or financial information like your National Insurance number or credit card details.

To help us improve GOV.UK, we’d like to know more about your visit today. We’ll send you a link to a feedback form. It will take only 2 minutes to fill in. Don’t worry we won’t send you spam or share your email address with anyone.